Incidental Mutation 'R7934:Nox4'
ID 648619
Institutional Source Beutler Lab
Gene Symbol Nox4
Ensembl Gene ENSMUSG00000030562
Gene Name NADPH oxidase 4
Synonyms
MMRRC Submission 045980-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7934 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 86895304-87047918 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86945032 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 65 (N65S)
Ref Sequence ENSEMBL: ENSMUSP00000070039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032781] [ENSMUST00000068829] [ENSMUST00000124057] [ENSMUST00000126887] [ENSMUST00000136577] [ENSMUST00000144267]
AlphaFold Q9JHI8
Predicted Effect probably damaging
Transcript: ENSMUST00000032781
AA Change: N65S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032781
Gene: ENSMUSG00000030562
AA Change: N65S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 8.3e-21 PFAM
Pfam:FAD_binding_8 306 417 2.8e-17 PFAM
Pfam:NAD_binding_6 423 561 7.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000068829
AA Change: N65S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070039
Gene: ENSMUSG00000030562
AA Change: N65S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 5.3e-27 PFAM
Pfam:FAD_binding_8 306 417 5.5e-17 PFAM
Pfam:NAD_binding_6 423 539 4.3e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124057
AA Change: N96S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119365
Gene: ENSMUSG00000030562
AA Change: N96S

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 134 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126887
SMART Domains Protein: ENSMUSP00000138336
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136577
SMART Domains Protein: ENSMUSP00000138274
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144267
SMART Domains Protein: ENSMUSP00000138143
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null allele display increased heart damage following pressure overload. Mice with a cardiomyocyte specific deletion show decreased damage following pressure overload. Mice homozygous for a different knock-out allele exhibit decreased suseptibility to bleomycin-induced fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,349,770 (GRCm39) A93V probably benign Het
Abca8b G A 11: 109,865,865 (GRCm39) T296I possibly damaging Het
Adamtsl1 A C 4: 86,161,962 (GRCm39) Y365S probably damaging Het
Ambp T A 4: 63,067,677 (GRCm39) I178F probably damaging Het
Ankle1 T C 8: 71,858,899 (GRCm39) V44A possibly damaging Het
Arhgef2 A G 3: 88,537,221 (GRCm39) E37G probably damaging Het
Atp2a2 A G 5: 122,599,639 (GRCm39) I584T probably benign Het
Ccdc171 T A 4: 83,614,492 (GRCm39) L1031* probably null Het
Cdh17 T A 4: 11,799,754 (GRCm39) probably null Het
Cdip1 T C 16: 4,586,422 (GRCm39) T203A probably benign Het
Ceacam1 C T 7: 25,163,220 (GRCm39) V338I possibly damaging Het
Cep78 G A 19: 15,933,754 (GRCm39) T608I probably damaging Het
Ces3a T A 8: 105,775,345 (GRCm39) probably null Het
Cfap210 G A 2: 69,612,450 (GRCm39) Q97* probably null Het
Chd7 A G 4: 8,854,121 (GRCm39) T1898A probably benign Het
Cpne6 T C 14: 55,750,066 (GRCm39) C66R possibly damaging Het
Creb1 G A 1: 64,609,372 (GRCm39) A108T probably benign Het
Ctnna3 A T 10: 64,421,747 (GRCm39) I514F probably damaging Het
Cyp2c55 T C 19: 39,030,535 (GRCm39) F456L probably damaging Het
Cyp2d40 A G 15: 82,648,212 (GRCm39) S34P probably damaging Het
Cyp2g1 A T 7: 26,518,618 (GRCm39) T378S probably damaging Het
Eif2b3 C A 4: 116,923,675 (GRCm39) Q297K probably benign Het
Fbll1 T C 11: 35,689,048 (GRCm39) N72D unknown Het
Fev C G 1: 74,921,632 (GRCm39) R106P probably damaging Het
Gal3st1 A G 11: 3,948,405 (GRCm39) Y204C probably damaging Het
Gm15130 A T 2: 110,964,582 (GRCm39) L180Q Het
Greb1l A T 18: 10,474,371 (GRCm39) K229* probably null Het
Haghl G T 17: 26,002,519 (GRCm39) T214K probably damaging Het
Hivep1 A G 13: 42,308,174 (GRCm39) H138R probably benign Het
Ighv1-53 G T 12: 115,122,236 (GRCm39) Y46* probably null Het
Igsf21 T C 4: 139,761,755 (GRCm39) T308A possibly damaging Het
Kcnb1 A G 2: 166,946,536 (GRCm39) S771P probably benign Het
Kndc1 T A 7: 139,501,402 (GRCm39) M897K probably benign Het
Macf1 T C 4: 123,367,727 (GRCm39) M2345V possibly damaging Het
Mettl2 T C 11: 105,019,773 (GRCm39) S137P probably benign Het
Mrpl15 A G 1: 4,844,725 (GRCm39) S189P probably benign Het
Ndrg2 T C 14: 52,143,661 (GRCm39) Q351R probably benign Het
Or1n1 A G 2: 36,750,228 (GRCm39) I44T possibly damaging Het
Or1p1b C T 11: 74,131,326 (GRCm39) S312F probably benign Het
Osbpl11 T A 16: 33,056,752 (GRCm39) W729R probably damaging Het
Oxct2b C A 4: 123,010,447 (GRCm39) C122* probably null Het
Pdcl3 A T 1: 39,026,782 (GRCm39) probably benign Het
Plcg1 A G 2: 160,616,498 (GRCm39) H1294R possibly damaging Het
Pnp2 C A 14: 51,201,903 (GRCm39) S296R probably benign Het
Ppp1r12c G A 7: 4,488,416 (GRCm39) Q337* probably null Het
Prr23a4 A G 9: 98,785,880 (GRCm39) R182G possibly damaging Het
Ranbp2 G A 10: 58,312,297 (GRCm39) V1006I probably damaging Het
Rxrg A G 1: 167,454,927 (GRCm39) D170G probably damaging Het
Sf3b3 T C 8: 111,548,162 (GRCm39) T691A probably benign Het
Slc1a4 A G 11: 20,258,518 (GRCm39) I307T probably damaging Het
Slc4a8 G A 15: 100,685,173 (GRCm39) V235I probably damaging Het
Srgap3 T A 6: 112,708,450 (GRCm39) I750F probably damaging Het
Trim30a A T 7: 104,061,448 (GRCm39) L282Q probably damaging Het
Tshr A G 12: 91,478,702 (GRCm39) K183R possibly damaging Het
Usp38 A T 8: 81,711,077 (GRCm39) L986Q probably damaging Het
Vmn1r257 T A 7: 22,391,439 (GRCm39) T102S possibly damaging Het
Vps18 A G 2: 119,124,122 (GRCm39) T350A probably benign Het
Zan T A 5: 137,461,841 (GRCm39) T1113S unknown Het
Zbtb37 A T 1: 160,857,305 (GRCm39) S312R probably damaging Het
Zeb1 A G 18: 5,748,703 (GRCm39) N90S probably benign Het
Zfp715 A T 7: 42,949,308 (GRCm39) Y217* probably null Het
Zfp9 T C 6: 118,441,847 (GRCm39) T272A probably damaging Het
Zfp943 T A 17: 22,212,361 (GRCm39) H482Q probably damaging Het
Zfp971 A T 2: 177,675,173 (GRCm39) K257N probably benign Het
Other mutations in Nox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Nox4 APN 7 87,025,424 (GRCm39) missense possibly damaging 0.89
IGL02711:Nox4 APN 7 87,046,076 (GRCm39) missense probably damaging 1.00
IGL03234:Nox4 APN 7 86,966,521 (GRCm39) critical splice donor site probably null
IGL03286:Nox4 APN 7 87,019,349 (GRCm39) splice site probably benign
BB001:Nox4 UTSW 7 87,023,589 (GRCm39) missense probably benign 0.00
BB011:Nox4 UTSW 7 87,023,589 (GRCm39) missense probably benign 0.00
LCD18:Nox4 UTSW 7 86,892,275 (GRCm39) unclassified probably benign
PIT4151001:Nox4 UTSW 7 86,954,097 (GRCm39) missense probably benign 0.02
R0717:Nox4 UTSW 7 86,954,098 (GRCm39) nonsense probably null
R1033:Nox4 UTSW 7 87,023,621 (GRCm39) missense probably damaging 0.99
R1135:Nox4 UTSW 7 86,972,997 (GRCm39) missense probably damaging 1.00
R1333:Nox4 UTSW 7 86,896,072 (GRCm39) missense possibly damaging 0.80
R1477:Nox4 UTSW 7 86,945,074 (GRCm39) missense probably benign 0.16
R1489:Nox4 UTSW 7 86,954,097 (GRCm39) missense probably damaging 0.99
R1579:Nox4 UTSW 7 87,019,231 (GRCm39) missense probably damaging 0.98
R1669:Nox4 UTSW 7 86,945,097 (GRCm39) missense probably benign 0.01
R1742:Nox4 UTSW 7 86,945,026 (GRCm39) missense possibly damaging 0.82
R1900:Nox4 UTSW 7 87,010,004 (GRCm39) nonsense probably null
R2112:Nox4 UTSW 7 87,021,216 (GRCm39) missense probably damaging 1.00
R2192:Nox4 UTSW 7 87,023,588 (GRCm39) missense probably benign 0.02
R2496:Nox4 UTSW 7 86,955,958 (GRCm39) missense probably benign 0.04
R2497:Nox4 UTSW 7 86,945,084 (GRCm39) nonsense probably null
R4158:Nox4 UTSW 7 87,046,032 (GRCm39) missense possibly damaging 0.95
R4160:Nox4 UTSW 7 87,046,032 (GRCm39) missense possibly damaging 0.95
R4281:Nox4 UTSW 7 86,946,732 (GRCm39) missense possibly damaging 0.77
R4685:Nox4 UTSW 7 86,946,716 (GRCm39) missense probably benign 0.36
R4791:Nox4 UTSW 7 86,954,055 (GRCm39) missense probably benign 0.35
R5001:Nox4 UTSW 7 87,010,011 (GRCm39) missense probably damaging 0.96
R5091:Nox4 UTSW 7 87,025,450 (GRCm39) missense probably damaging 1.00
R5174:Nox4 UTSW 7 86,972,974 (GRCm39) missense probably benign 0.10
R5220:Nox4 UTSW 7 87,023,616 (GRCm39) missense possibly damaging 0.91
R5278:Nox4 UTSW 7 87,021,134 (GRCm39) missense probably damaging 1.00
R5723:Nox4 UTSW 7 86,954,181 (GRCm39) intron probably benign
R5840:Nox4 UTSW 7 87,010,001 (GRCm39) missense probably benign 0.00
R5852:Nox4 UTSW 7 86,988,172 (GRCm39) missense probably damaging 0.98
R7516:Nox4 UTSW 7 86,970,905 (GRCm39) missense probably benign
R7529:Nox4 UTSW 7 87,044,976 (GRCm39) missense unknown
R7587:Nox4 UTSW 7 86,966,510 (GRCm39) missense probably damaging 1.00
R7643:Nox4 UTSW 7 86,972,962 (GRCm39) missense probably damaging 1.00
R7660:Nox4 UTSW 7 87,019,230 (GRCm39) missense probably damaging 0.97
R7786:Nox4 UTSW 7 86,945,050 (GRCm39) missense probably damaging 0.99
R7871:Nox4 UTSW 7 86,963,335 (GRCm39) missense possibly damaging 0.95
R7924:Nox4 UTSW 7 87,023,589 (GRCm39) missense probably benign 0.00
R8024:Nox4 UTSW 7 86,954,118 (GRCm39) missense probably damaging 0.99
R8053:Nox4 UTSW 7 87,019,255 (GRCm39) missense probably damaging 1.00
R8269:Nox4 UTSW 7 86,955,930 (GRCm39) splice site probably benign
R8376:Nox4 UTSW 7 87,023,592 (GRCm39) missense probably damaging 1.00
R8461:Nox4 UTSW 7 86,966,479 (GRCm39) missense probably damaging 0.99
R9041:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9100:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9101:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9102:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9109:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9135:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9136:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9220:Nox4 UTSW 7 86,970,774 (GRCm39) missense probably benign 0.01
R9252:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9298:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9306:Nox4 UTSW 7 86,896,781 (GRCm39) missense probably benign 0.01
R9338:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9339:Nox4 UTSW 7 87,025,448 (GRCm39) missense probably benign 0.05
R9448:Nox4 UTSW 7 87,045,001 (GRCm39) missense unknown
X0021:Nox4 UTSW 7 87,044,886 (GRCm39) missense probably damaging 1.00
Z1177:Nox4 UTSW 7 87,044,920 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TTTGGGAGCTTTGGTAAGATCAAAG -3'
(R):5'- TGTATCCCTTACCACCACTGAG -3'

Sequencing Primer
(F):5'- GAAACTCTACAGCATTCTTGAAGG -3'
(R):5'- TTACCACCACTGAGAAGAGATATTC -3'
Posted On 2020-09-15