Incidental Mutation 'R7934:Kndc1'
ID 648621
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, 2410012C07Rik, very-kind, VKIND
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7934 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 139894696-139941537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 139921486 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 897 (M897K)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
AlphaFold Q0KK55
Predicted Effect probably benign
Transcript: ENSMUST00000053445
AA Change: M897K

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: M897K

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,015 A93V probably benign Het
7420426K07Rik A G 9: 98,903,827 R182G possibly damaging Het
Abca8b G A 11: 109,975,039 T296I possibly damaging Het
Adamtsl1 A C 4: 86,243,725 Y365S probably damaging Het
Ambp T A 4: 63,149,440 I178F probably damaging Het
Ankle1 T C 8: 71,406,255 V44A possibly damaging Het
Arhgef2 A G 3: 88,629,914 E37G probably damaging Het
Atp2a2 A G 5: 122,461,576 I584T probably benign Het
Ccdc171 T A 4: 83,696,255 L1031* probably null Het
Ccdc173 G A 2: 69,782,106 Q97* probably null Het
Cdh17 T A 4: 11,799,754 probably null Het
Cdip1 T C 16: 4,768,558 T203A probably benign Het
Ceacam1 C T 7: 25,463,795 V338I possibly damaging Het
Cep78 G A 19: 15,956,390 T608I probably damaging Het
Ces3a T A 8: 105,048,713 probably null Het
Chd7 A G 4: 8,854,121 T1898A probably benign Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Creb1 G A 1: 64,570,213 A108T probably benign Het
Ctnna3 A T 10: 64,585,968 I514F probably damaging Het
Cyp2c55 T C 19: 39,042,091 F456L probably damaging Het
Cyp2d40 A G 15: 82,764,011 S34P probably damaging Het
Cyp2g1 A T 7: 26,819,193 T378S probably damaging Het
Eif2b3 C A 4: 117,066,478 Q297K probably benign Het
Fbll1 T C 11: 35,798,221 N72D unknown Het
Fev C G 1: 74,882,473 R106P probably damaging Het
Gal3st1 A G 11: 3,998,405 Y204C probably damaging Het
Gm15130 A T 2: 111,134,237 L180Q Het
Gm8693 T A 7: 22,692,014 T102S possibly damaging Het
Greb1l A T 18: 10,474,371 K229* probably null Het
Haghl G T 17: 25,783,545 T214K probably damaging Het
Hivep1 A G 13: 42,154,698 H138R probably benign Het
Ighv1-53 G T 12: 115,158,616 Y46* probably null Het
Igsf21 T C 4: 140,034,444 T308A possibly damaging Het
Kcnb1 A G 2: 167,104,616 S771P probably benign Het
Macf1 T C 4: 123,473,934 M2345V possibly damaging Het
Mettl2 T C 11: 105,128,947 S137P probably benign Het
Mrpl15 A G 1: 4,774,502 S189P probably benign Het
Ndrg2 T C 14: 51,906,204 Q351R probably benign Het
Nox4 A G 7: 87,295,824 N65S probably damaging Het
Olfr351 A G 2: 36,860,216 I44T possibly damaging Het
Olfr404-ps1 C T 11: 74,240,500 S312F probably benign Het
Osbpl11 T A 16: 33,236,382 W729R probably damaging Het
Oxct2b C A 4: 123,116,654 C122* probably null Het
Pdcl3 A T 1: 38,987,701 probably benign Het
Plcg1 A G 2: 160,774,578 H1294R possibly damaging Het
Pnp2 C A 14: 50,964,446 S296R probably benign Het
Ppp1r12c G A 7: 4,485,417 Q337* probably null Het
Ranbp2 G A 10: 58,476,475 V1006I probably damaging Het
Rxrg A G 1: 167,627,358 D170G probably damaging Het
Sf3b3 T C 8: 110,821,530 T691A probably benign Het
Slc1a4 A G 11: 20,308,518 I307T probably damaging Het
Slc4a8 G A 15: 100,787,292 V235I probably damaging Het
Srgap3 T A 6: 112,731,489 I750F probably damaging Het
Trim30a A T 7: 104,412,241 L282Q probably damaging Het
Tshr A G 12: 91,511,928 K183R possibly damaging Het
Usp38 A T 8: 80,984,448 L986Q probably damaging Het
Vps18 A G 2: 119,293,641 T350A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zbtb37 A T 1: 161,029,735 S312R probably damaging Het
Zeb1 A G 18: 5,748,703 N90S probably benign Het
Zfp715 A T 7: 43,299,884 Y217* probably null Het
Zfp9 T C 6: 118,464,886 T272A probably damaging Het
Zfp943 T A 17: 21,993,380 H482Q probably damaging Het
Zfp971 A T 2: 178,033,380 K257N probably benign Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139901988 splice site probably benign
IGL01061:Kndc1 APN 7 139922694 missense probably benign 0.00
IGL01099:Kndc1 APN 7 139920784 missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139913972 splice site probably benign
IGL01767:Kndc1 APN 7 139930046 missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139914194 missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139923790 missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139920767 missense probably benign 0.19
IGL02411:Kndc1 APN 7 139921913 critical splice donor site probably null
IGL02472:Kndc1 APN 7 139910901 missense probably benign 0.01
IGL02537:Kndc1 APN 7 139910410 missense probably benign 0.01
IGL02708:Kndc1 APN 7 139901181 missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139921509 missense probably benign 0.28
IGL03160:Kndc1 APN 7 139920689 nonsense probably null
IGL03138:Kndc1 UTSW 7 139939878 missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139923776 frame shift probably null
PIT4696001:Kndc1 UTSW 7 139932917 missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139910304 missense probably benign 0.00
R0384:Kndc1 UTSW 7 139910599 missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139930124 missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139908996 missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139914023 missense probably null 0.19
R0530:Kndc1 UTSW 7 139901237 missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139923735 missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139922684 missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139927408 missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139930756 missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139927711 missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139921280 missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139930761 missense probably benign 0.02
R2103:Kndc1 UTSW 7 139921234 missense probably benign 0.01
R2128:Kndc1 UTSW 7 139930112 missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139921822 missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139901207 missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139902060 splice site probably benign
R3747:Kndc1 UTSW 7 139927904 critical splice donor site probably null
R3848:Kndc1 UTSW 7 139908977 missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139930028 missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4044:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4095:Kndc1 UTSW 7 139937025 missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139910882 missense probably benign 0.01
R4478:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139910286 missense probably benign 0.00
R4540:Kndc1 UTSW 7 139921427 nonsense probably null
R4584:Kndc1 UTSW 7 139901243 missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139921779 missense probably benign 0.02
R4705:Kndc1 UTSW 7 139930123 missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139924031 nonsense probably null
R4859:Kndc1 UTSW 7 139921905 missense probably benign 0.03
R5004:Kndc1 UTSW 7 139932879 nonsense probably null
R5037:Kndc1 UTSW 7 139910455 missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139936809 missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139908962 missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139931889 missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139927891 missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139924111 missense probably benign 0.00
R5888:Kndc1 UTSW 7 139895217 missense probably benign 0.00
R5942:Kndc1 UTSW 7 139936879 missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139939827 missense probably benign 0.05
R5990:Kndc1 UTSW 7 139927420 missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139923775 frame shift probably null
R6076:Kndc1 UTSW 7 139902038 missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139923802 missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139921213 missense probably benign 0.04
R6276:Kndc1 UTSW 7 139921063 missense probably benign
R6367:Kndc1 UTSW 7 139913506 missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139922751 critical splice donor site probably null
R6745:Kndc1 UTSW 7 139920976 missense probably benign 0.02
R6886:Kndc1 UTSW 7 139913569 missense probably benign 0.01
R6912:Kndc1 UTSW 7 139910278 missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139921828 missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139936836 missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139931860 missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139920783 missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139909043 missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139920696 missense probably benign 0.01
R7570:Kndc1 UTSW 7 139923775 frame shift probably null
R7625:Kndc1 UTSW 7 139938017 missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139895260 missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139939838 missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139923816 missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139920964 missense possibly damaging 0.57
R8011:Kndc1 UTSW 7 139910620 missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139918844 missense probably benign 0.01
R8134:Kndc1 UTSW 7 139901369 splice site probably null
R8197:Kndc1 UTSW 7 139913531 missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139924045 missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139913518 missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139913518 missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139901205 missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139923753 missense probably benign 0.27
R8735:Kndc1 UTSW 7 139910214 missense probably benign 0.00
R8816:Kndc1 UTSW 7 139937996 missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139924061 missense possibly damaging 0.95
R8961:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9002:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139921441 missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139895224 missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139921476 missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139930118 missense probably benign 0.00
R9510:Kndc1 UTSW 7 139930118 missense probably benign 0.00
R9518:Kndc1 UTSW 7 139939914 missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139920704 missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139921912 missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139910813 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTCTCGACACCCATGTAAG -3'
(R):5'- AGCTGTCTCAGGACTTTGGG -3'

Sequencing Primer
(F):5'- TAAGGCTGCAGCGAGTCC -3'
(R):5'- TGCAGGCTCAAGTTGGAAGC -3'
Posted On 2020-09-15