Incidental Mutation 'R7934:Slc1a4'
ID 648630
Institutional Source Beutler Lab
Gene Symbol Slc1a4
Ensembl Gene ENSMUSG00000020142
Gene Name solute carrier family 1 (glutamate/neutral amino acid transporter), member 4
Synonyms ASCT1
MMRRC Submission 045980-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7934 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 20252180-20282713 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20258518 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 307 (I307T)
Ref Sequence ENSEMBL: ENSMUSP00000105223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004634] [ENSMUST00000109594]
AlphaFold O35874
Predicted Effect probably damaging
Transcript: ENSMUST00000004634
AA Change: I227T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004634
Gene: ENSMUSG00000020142
AA Change: I227T

DomainStartEndE-ValueType
Pfam:SDF 1 397 2.7e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109594
AA Change: I307T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105223
Gene: ENSMUSG00000020142
AA Change: I307T

DomainStartEndE-ValueType
Pfam:SDF 44 477 4.2e-121 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-dependent neutral amino acid transporter for alanine, serine, cysteine, and threonine. Defects in this gene have been associated with developmental delay, microcephaly, and intellectual disability. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,349,770 (GRCm39) A93V probably benign Het
Abca8b G A 11: 109,865,865 (GRCm39) T296I possibly damaging Het
Adamtsl1 A C 4: 86,161,962 (GRCm39) Y365S probably damaging Het
Ambp T A 4: 63,067,677 (GRCm39) I178F probably damaging Het
Ankle1 T C 8: 71,858,899 (GRCm39) V44A possibly damaging Het
Arhgef2 A G 3: 88,537,221 (GRCm39) E37G probably damaging Het
Atp2a2 A G 5: 122,599,639 (GRCm39) I584T probably benign Het
Ccdc171 T A 4: 83,614,492 (GRCm39) L1031* probably null Het
Cdh17 T A 4: 11,799,754 (GRCm39) probably null Het
Cdip1 T C 16: 4,586,422 (GRCm39) T203A probably benign Het
Ceacam1 C T 7: 25,163,220 (GRCm39) V338I possibly damaging Het
Cep78 G A 19: 15,933,754 (GRCm39) T608I probably damaging Het
Ces3a T A 8: 105,775,345 (GRCm39) probably null Het
Cfap210 G A 2: 69,612,450 (GRCm39) Q97* probably null Het
Chd7 A G 4: 8,854,121 (GRCm39) T1898A probably benign Het
Cpne6 T C 14: 55,750,066 (GRCm39) C66R possibly damaging Het
Creb1 G A 1: 64,609,372 (GRCm39) A108T probably benign Het
Ctnna3 A T 10: 64,421,747 (GRCm39) I514F probably damaging Het
Cyp2c55 T C 19: 39,030,535 (GRCm39) F456L probably damaging Het
Cyp2d40 A G 15: 82,648,212 (GRCm39) S34P probably damaging Het
Cyp2g1 A T 7: 26,518,618 (GRCm39) T378S probably damaging Het
Eif2b3 C A 4: 116,923,675 (GRCm39) Q297K probably benign Het
Fbll1 T C 11: 35,689,048 (GRCm39) N72D unknown Het
Fev C G 1: 74,921,632 (GRCm39) R106P probably damaging Het
Gal3st1 A G 11: 3,948,405 (GRCm39) Y204C probably damaging Het
Gm15130 A T 2: 110,964,582 (GRCm39) L180Q Het
Greb1l A T 18: 10,474,371 (GRCm39) K229* probably null Het
Haghl G T 17: 26,002,519 (GRCm39) T214K probably damaging Het
Hivep1 A G 13: 42,308,174 (GRCm39) H138R probably benign Het
Ighv1-53 G T 12: 115,122,236 (GRCm39) Y46* probably null Het
Igsf21 T C 4: 139,761,755 (GRCm39) T308A possibly damaging Het
Kcnb1 A G 2: 166,946,536 (GRCm39) S771P probably benign Het
Kndc1 T A 7: 139,501,402 (GRCm39) M897K probably benign Het
Macf1 T C 4: 123,367,727 (GRCm39) M2345V possibly damaging Het
Mettl2 T C 11: 105,019,773 (GRCm39) S137P probably benign Het
Mrpl15 A G 1: 4,844,725 (GRCm39) S189P probably benign Het
Ndrg2 T C 14: 52,143,661 (GRCm39) Q351R probably benign Het
Nox4 A G 7: 86,945,032 (GRCm39) N65S probably damaging Het
Or1n1 A G 2: 36,750,228 (GRCm39) I44T possibly damaging Het
Or1p1b C T 11: 74,131,326 (GRCm39) S312F probably benign Het
Osbpl11 T A 16: 33,056,752 (GRCm39) W729R probably damaging Het
Oxct2b C A 4: 123,010,447 (GRCm39) C122* probably null Het
Pdcl3 A T 1: 39,026,782 (GRCm39) probably benign Het
Plcg1 A G 2: 160,616,498 (GRCm39) H1294R possibly damaging Het
Pnp2 C A 14: 51,201,903 (GRCm39) S296R probably benign Het
Ppp1r12c G A 7: 4,488,416 (GRCm39) Q337* probably null Het
Prr23a4 A G 9: 98,785,880 (GRCm39) R182G possibly damaging Het
Ranbp2 G A 10: 58,312,297 (GRCm39) V1006I probably damaging Het
Rxrg A G 1: 167,454,927 (GRCm39) D170G probably damaging Het
Sf3b3 T C 8: 111,548,162 (GRCm39) T691A probably benign Het
Slc4a8 G A 15: 100,685,173 (GRCm39) V235I probably damaging Het
Srgap3 T A 6: 112,708,450 (GRCm39) I750F probably damaging Het
Trim30a A T 7: 104,061,448 (GRCm39) L282Q probably damaging Het
Tshr A G 12: 91,478,702 (GRCm39) K183R possibly damaging Het
Usp38 A T 8: 81,711,077 (GRCm39) L986Q probably damaging Het
Vmn1r257 T A 7: 22,391,439 (GRCm39) T102S possibly damaging Het
Vps18 A G 2: 119,124,122 (GRCm39) T350A probably benign Het
Zan T A 5: 137,461,841 (GRCm39) T1113S unknown Het
Zbtb37 A T 1: 160,857,305 (GRCm39) S312R probably damaging Het
Zeb1 A G 18: 5,748,703 (GRCm39) N90S probably benign Het
Zfp715 A T 7: 42,949,308 (GRCm39) Y217* probably null Het
Zfp9 T C 6: 118,441,847 (GRCm39) T272A probably damaging Het
Zfp943 T A 17: 22,212,361 (GRCm39) H482Q probably damaging Het
Zfp971 A T 2: 177,675,173 (GRCm39) K257N probably benign Het
Other mutations in Slc1a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Slc1a4 APN 11 20,258,644 (GRCm39) splice site probably benign
IGL01889:Slc1a4 APN 11 20,264,089 (GRCm39) splice site probably benign
IGL02725:Slc1a4 APN 11 20,258,408 (GRCm39) missense probably damaging 1.00
IGL03409:Slc1a4 APN 11 20,256,506 (GRCm39) missense probably damaging 1.00
G1Funyon:Slc1a4 UTSW 11 20,282,286 (GRCm39) missense probably damaging 1.00
R0085:Slc1a4 UTSW 11 20,254,510 (GRCm39) splice site probably benign
R0771:Slc1a4 UTSW 11 20,256,467 (GRCm39) missense probably damaging 1.00
R0898:Slc1a4 UTSW 11 20,254,349 (GRCm39) missense probably damaging 1.00
R1326:Slc1a4 UTSW 11 20,282,159 (GRCm39) missense probably damaging 1.00
R1992:Slc1a4 UTSW 11 20,254,375 (GRCm39) missense probably benign 0.31
R2497:Slc1a4 UTSW 11 20,282,620 (GRCm39) start gained probably benign
R3498:Slc1a4 UTSW 11 20,263,973 (GRCm39) missense probably damaging 1.00
R4608:Slc1a4 UTSW 11 20,254,348 (GRCm39) missense probably damaging 1.00
R4631:Slc1a4 UTSW 11 20,258,452 (GRCm39) missense probably damaging 1.00
R4885:Slc1a4 UTSW 11 20,254,384 (GRCm39) missense probably damaging 1.00
R4911:Slc1a4 UTSW 11 20,282,166 (GRCm39) missense probably damaging 1.00
R5533:Slc1a4 UTSW 11 20,254,417 (GRCm39) missense probably benign 0.01
R5548:Slc1a4 UTSW 11 20,254,429 (GRCm39) missense possibly damaging 0.68
R6523:Slc1a4 UTSW 11 20,282,114 (GRCm39) missense probably damaging 1.00
R6863:Slc1a4 UTSW 11 20,264,001 (GRCm39) missense probably damaging 1.00
R6941:Slc1a4 UTSW 11 20,254,346 (GRCm39) missense probably damaging 1.00
R7508:Slc1a4 UTSW 11 20,256,487 (GRCm39) missense probably damaging 1.00
R7747:Slc1a4 UTSW 11 20,258,587 (GRCm39) missense probably damaging 1.00
R7748:Slc1a4 UTSW 11 20,282,252 (GRCm39) missense probably damaging 1.00
R8142:Slc1a4 UTSW 11 20,257,890 (GRCm39) critical splice donor site probably null
R8301:Slc1a4 UTSW 11 20,282,286 (GRCm39) missense probably damaging 1.00
R8398:Slc1a4 UTSW 11 20,257,982 (GRCm39) missense probably damaging 1.00
R8827:Slc1a4 UTSW 11 20,270,237 (GRCm39) splice site probably benign
R9031:Slc1a4 UTSW 11 20,282,532 (GRCm39) start gained probably benign
R9132:Slc1a4 UTSW 11 20,258,527 (GRCm39) missense probably damaging 1.00
R9280:Slc1a4 UTSW 11 20,282,325 (GRCm39) missense probably damaging 1.00
R9352:Slc1a4 UTSW 11 20,282,025 (GRCm39) missense probably damaging 0.97
R9548:Slc1a4 UTSW 11 20,258,041 (GRCm39) missense probably damaging 1.00
R9616:Slc1a4 UTSW 11 20,282,403 (GRCm39) missense probably benign
X0025:Slc1a4 UTSW 11 20,268,703 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTCAGTACACAGTGTTCC -3'
(R):5'- AGAAGATCCAGTTGAAAGTCCCTG -3'

Sequencing Primer
(F):5'- TGTTCCCAAGAGAATCACTGGGC -3'
(R):5'- TTGAAAGTCCCTGGGAGGCTC -3'
Posted On 2020-09-15