Incidental Mutation 'R7934:Zfp943'
ID 648645
Institutional Source Beutler Lab
Gene Symbol Zfp943
Ensembl Gene ENSMUSG00000053347
Gene Name zinc finger prtoein 943
Synonyms 4930432O21Rik
MMRRC Submission 045980-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.250) question?
Stock # R7934 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 22181540-22213347 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 22212361 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 482 (H482Q)
Ref Sequence ENSEMBL: ENSMUSP00000059554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055349] [ENSMUST00000153985] [ENSMUST00000174015]
AlphaFold Q6NZP4
Predicted Effect probably damaging
Transcript: ENSMUST00000055349
AA Change: H482Q

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059554
Gene: ENSMUSG00000053347
AA Change: H482Q

DomainStartEndE-ValueType
KRAB 13 72 2.62e-18 SMART
ZnF_C2H2 180 202 1.6e-4 SMART
ZnF_C2H2 208 230 1.38e-3 SMART
ZnF_C2H2 236 258 1.13e-4 SMART
ZnF_C2H2 264 286 1.03e-2 SMART
ZnF_C2H2 292 314 2.24e-3 SMART
ZnF_C2H2 320 342 9.58e-3 SMART
ZnF_C2H2 348 370 5.67e-5 SMART
ZnF_C2H2 376 398 4.54e-4 SMART
ZnF_C2H2 404 426 2.15e-5 SMART
ZnF_C2H2 432 454 5.59e-4 SMART
ZnF_C2H2 460 482 3.34e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153985
SMART Domains Protein: ENSMUSP00000115817
Gene: ENSMUSG00000053347

DomainStartEndE-ValueType
KRAB 13 73 3.51e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174015
SMART Domains Protein: ENSMUSP00000133735
Gene: ENSMUSG00000053347

DomainStartEndE-ValueType
KRAB 13 60 3.79e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,349,770 (GRCm39) A93V probably benign Het
Abca8b G A 11: 109,865,865 (GRCm39) T296I possibly damaging Het
Adamtsl1 A C 4: 86,161,962 (GRCm39) Y365S probably damaging Het
Ambp T A 4: 63,067,677 (GRCm39) I178F probably damaging Het
Ankle1 T C 8: 71,858,899 (GRCm39) V44A possibly damaging Het
Arhgef2 A G 3: 88,537,221 (GRCm39) E37G probably damaging Het
Atp2a2 A G 5: 122,599,639 (GRCm39) I584T probably benign Het
Ccdc171 T A 4: 83,614,492 (GRCm39) L1031* probably null Het
Cdh17 T A 4: 11,799,754 (GRCm39) probably null Het
Cdip1 T C 16: 4,586,422 (GRCm39) T203A probably benign Het
Ceacam1 C T 7: 25,163,220 (GRCm39) V338I possibly damaging Het
Cep78 G A 19: 15,933,754 (GRCm39) T608I probably damaging Het
Ces3a T A 8: 105,775,345 (GRCm39) probably null Het
Cfap210 G A 2: 69,612,450 (GRCm39) Q97* probably null Het
Chd7 A G 4: 8,854,121 (GRCm39) T1898A probably benign Het
Cpne6 T C 14: 55,750,066 (GRCm39) C66R possibly damaging Het
Creb1 G A 1: 64,609,372 (GRCm39) A108T probably benign Het
Ctnna3 A T 10: 64,421,747 (GRCm39) I514F probably damaging Het
Cyp2c55 T C 19: 39,030,535 (GRCm39) F456L probably damaging Het
Cyp2d40 A G 15: 82,648,212 (GRCm39) S34P probably damaging Het
Cyp2g1 A T 7: 26,518,618 (GRCm39) T378S probably damaging Het
Eif2b3 C A 4: 116,923,675 (GRCm39) Q297K probably benign Het
Fbll1 T C 11: 35,689,048 (GRCm39) N72D unknown Het
Fev C G 1: 74,921,632 (GRCm39) R106P probably damaging Het
Gal3st1 A G 11: 3,948,405 (GRCm39) Y204C probably damaging Het
Gm15130 A T 2: 110,964,582 (GRCm39) L180Q Het
Greb1l A T 18: 10,474,371 (GRCm39) K229* probably null Het
Haghl G T 17: 26,002,519 (GRCm39) T214K probably damaging Het
Hivep1 A G 13: 42,308,174 (GRCm39) H138R probably benign Het
Ighv1-53 G T 12: 115,122,236 (GRCm39) Y46* probably null Het
Igsf21 T C 4: 139,761,755 (GRCm39) T308A possibly damaging Het
Kcnb1 A G 2: 166,946,536 (GRCm39) S771P probably benign Het
Kndc1 T A 7: 139,501,402 (GRCm39) M897K probably benign Het
Macf1 T C 4: 123,367,727 (GRCm39) M2345V possibly damaging Het
Mettl2 T C 11: 105,019,773 (GRCm39) S137P probably benign Het
Mrpl15 A G 1: 4,844,725 (GRCm39) S189P probably benign Het
Ndrg2 T C 14: 52,143,661 (GRCm39) Q351R probably benign Het
Nox4 A G 7: 86,945,032 (GRCm39) N65S probably damaging Het
Or1n1 A G 2: 36,750,228 (GRCm39) I44T possibly damaging Het
Or1p1b C T 11: 74,131,326 (GRCm39) S312F probably benign Het
Osbpl11 T A 16: 33,056,752 (GRCm39) W729R probably damaging Het
Oxct2b C A 4: 123,010,447 (GRCm39) C122* probably null Het
Pdcl3 A T 1: 39,026,782 (GRCm39) probably benign Het
Plcg1 A G 2: 160,616,498 (GRCm39) H1294R possibly damaging Het
Pnp2 C A 14: 51,201,903 (GRCm39) S296R probably benign Het
Ppp1r12c G A 7: 4,488,416 (GRCm39) Q337* probably null Het
Prr23a4 A G 9: 98,785,880 (GRCm39) R182G possibly damaging Het
Ranbp2 G A 10: 58,312,297 (GRCm39) V1006I probably damaging Het
Rxrg A G 1: 167,454,927 (GRCm39) D170G probably damaging Het
Sf3b3 T C 8: 111,548,162 (GRCm39) T691A probably benign Het
Slc1a4 A G 11: 20,258,518 (GRCm39) I307T probably damaging Het
Slc4a8 G A 15: 100,685,173 (GRCm39) V235I probably damaging Het
Srgap3 T A 6: 112,708,450 (GRCm39) I750F probably damaging Het
Trim30a A T 7: 104,061,448 (GRCm39) L282Q probably damaging Het
Tshr A G 12: 91,478,702 (GRCm39) K183R possibly damaging Het
Usp38 A T 8: 81,711,077 (GRCm39) L986Q probably damaging Het
Vmn1r257 T A 7: 22,391,439 (GRCm39) T102S possibly damaging Het
Vps18 A G 2: 119,124,122 (GRCm39) T350A probably benign Het
Zan T A 5: 137,461,841 (GRCm39) T1113S unknown Het
Zbtb37 A T 1: 160,857,305 (GRCm39) S312R probably damaging Het
Zeb1 A G 18: 5,748,703 (GRCm39) N90S probably benign Het
Zfp715 A T 7: 42,949,308 (GRCm39) Y217* probably null Het
Zfp9 T C 6: 118,441,847 (GRCm39) T272A probably damaging Het
Zfp971 A T 2: 177,675,173 (GRCm39) K257N probably benign Het
Other mutations in Zfp943
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03101:Zfp943 APN 17 22,211,156 (GRCm39) missense probably damaging 1.00
R0019:Zfp943 UTSW 17 22,211,070 (GRCm39) intron probably benign
R0827:Zfp943 UTSW 17 22,211,071 (GRCm39) critical splice acceptor site probably null
R1824:Zfp943 UTSW 17 22,211,361 (GRCm39) missense probably benign 0.32
R1958:Zfp943 UTSW 17 22,211,979 (GRCm39) missense probably damaging 0.99
R2174:Zfp943 UTSW 17 22,211,804 (GRCm39) missense probably damaging 1.00
R3790:Zfp943 UTSW 17 22,211,403 (GRCm39) missense possibly damaging 0.81
R4093:Zfp943 UTSW 17 22,211,963 (GRCm39) missense probably damaging 1.00
R4094:Zfp943 UTSW 17 22,211,963 (GRCm39) missense probably damaging 1.00
R4352:Zfp943 UTSW 17 22,212,104 (GRCm39) missense probably damaging 0.98
R4677:Zfp943 UTSW 17 22,212,176 (GRCm39) missense probably benign 0.17
R4735:Zfp943 UTSW 17 22,211,391 (GRCm39) missense probably benign 0.03
R5201:Zfp943 UTSW 17 22,211,794 (GRCm39) missense probably damaging 1.00
R5492:Zfp943 UTSW 17 22,212,056 (GRCm39) missense probably damaging 1.00
R5642:Zfp943 UTSW 17 22,211,813 (GRCm39) missense probably damaging 1.00
R6031:Zfp943 UTSW 17 22,212,357 (GRCm39) missense probably benign
R6031:Zfp943 UTSW 17 22,212,357 (GRCm39) missense probably benign
R6667:Zfp943 UTSW 17 22,211,889 (GRCm39) missense probably damaging 1.00
R6864:Zfp943 UTSW 17 22,211,593 (GRCm39) missense probably damaging 1.00
R6976:Zfp943 UTSW 17 22,209,922 (GRCm39) missense possibly damaging 0.47
R7837:Zfp943 UTSW 17 22,211,346 (GRCm39) missense probably benign 0.39
R8302:Zfp943 UTSW 17 22,211,091 (GRCm39) missense probably benign 0.18
R8323:Zfp943 UTSW 17 22,211,763 (GRCm39) missense possibly damaging 0.95
R9025:Zfp943 UTSW 17 22,211,321 (GRCm39) missense possibly damaging 0.67
R9101:Zfp943 UTSW 17 22,212,392 (GRCm39) missense possibly damaging 0.83
R9279:Zfp943 UTSW 17 22,209,832 (GRCm39) missense possibly damaging 0.89
R9640:Zfp943 UTSW 17 22,209,899 (GRCm39) missense probably damaging 0.99
Z1176:Zfp943 UTSW 17 22,211,946 (GRCm39) missense probably damaging 1.00
Z1177:Zfp943 UTSW 17 22,207,063 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCGACCTTAGAAGACATCAG -3'
(R):5'- TCAGACCTGAGATTCTGGAAAAG -3'

Sequencing Primer
(F):5'- CGACCTTAGAAGACATCAGAGAATTC -3'
(R):5'- TCAACAGTGAAGGATTTGCCC -3'
Posted On 2020-09-15