Incidental Mutation 'R7934:Greb1l'
ID648648
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
MMRRC Submission
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7934 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 10474371 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 229 (K229*)
Ref Sequence ENSEMBL: ENSMUSP00000049003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532]
Predicted Effect probably null
Transcript: ENSMUST00000048977
AA Change: K229*
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: K229*

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172532
AA Change: K229*
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: K229*

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110082I17Rik G A 5: 139,364,015 A93V probably benign Het
7420426K07Rik A G 9: 98,903,827 R182G possibly damaging Het
Abca8b G A 11: 109,975,039 T296I possibly damaging Het
Adamtsl1 A C 4: 86,243,725 Y365S probably damaging Het
Ambp T A 4: 63,149,440 I178F probably damaging Het
Ankle1 T C 8: 71,406,255 V44A possibly damaging Het
Arhgef2 A G 3: 88,629,914 E37G probably damaging Het
Atp2a2 A G 5: 122,461,576 I584T probably benign Het
Ccdc171 T A 4: 83,696,255 L1031* probably null Het
Ccdc173 G A 2: 69,782,106 Q97* probably null Het
Cdh17 T A 4: 11,799,754 probably null Het
Cdip1 T C 16: 4,768,558 T203A probably benign Het
Ceacam1 C T 7: 25,463,795 V338I possibly damaging Het
Cep78 G A 19: 15,956,390 T608I probably damaging Het
Ces3a T A 8: 105,048,713 probably null Het
Chd7 A G 4: 8,854,121 T1898A probably benign Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Creb1 G A 1: 64,570,213 A108T probably benign Het
Ctnna3 A T 10: 64,585,968 I514F probably damaging Het
Cyp2c55 T C 19: 39,042,091 F456L probably damaging Het
Cyp2d40 A G 15: 82,764,011 S34P probably damaging Het
Cyp2g1 A T 7: 26,819,193 T378S probably damaging Het
Eif2b3 C A 4: 117,066,478 Q297K probably benign Het
Fbll1 T C 11: 35,798,221 N72D unknown Het
Fev C G 1: 74,882,473 R106P probably damaging Het
Gal3st1 A G 11: 3,998,405 Y204C probably damaging Het
Gm15130 A T 2: 111,134,237 L180Q Het
Gm8693 T A 7: 22,692,014 T102S possibly damaging Het
Haghl G T 17: 25,783,545 T214K probably damaging Het
Hivep1 A G 13: 42,154,698 H138R probably benign Het
Ighv1-53 G T 12: 115,158,616 Y46* probably null Het
Igsf21 T C 4: 140,034,444 T308A possibly damaging Het
Kcnb1 A G 2: 167,104,616 S771P probably benign Het
Kndc1 T A 7: 139,921,486 M897K probably benign Het
Macf1 T C 4: 123,473,934 M2345V possibly damaging Het
Mettl2 T C 11: 105,128,947 S137P probably benign Het
Mrpl15 A G 1: 4,774,502 S189P probably benign Het
Ndrg2 T C 14: 51,906,204 Q351R probably benign Het
Nox4 A G 7: 87,295,824 N65S probably damaging Het
Olfr351 A G 2: 36,860,216 I44T possibly damaging Het
Olfr404-ps1 C T 11: 74,240,500 S312F probably benign Het
Osbpl11 T A 16: 33,236,382 W729R probably damaging Het
Oxct2b C A 4: 123,116,654 C122* probably null Het
Pdcl3 A T 1: 38,987,701 probably benign Het
Plcg1 A G 2: 160,774,578 H1294R possibly damaging Het
Pnp2 C A 14: 50,964,446 S296R probably benign Het
Ppp1r12c G A 7: 4,485,417 Q337* probably null Het
Ranbp2 G A 10: 58,476,475 V1006I probably damaging Het
Rxrg A G 1: 167,627,358 D170G probably damaging Het
Sf3b3 T C 8: 110,821,530 T691A probably benign Het
Slc1a4 A G 11: 20,308,518 I307T probably damaging Het
Slc4a8 G A 15: 100,787,292 V235I probably damaging Het
Srgap3 T A 6: 112,731,489 I750F probably damaging Het
Trim30a A T 7: 104,412,241 L282Q probably damaging Het
Tshr A G 12: 91,511,928 K183R possibly damaging Het
Usp38 A T 8: 80,984,448 L986Q probably damaging Het
Vps18 A G 2: 119,293,641 T350A probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zbtb37 A T 1: 161,029,735 S312R probably damaging Het
Zeb1 A G 18: 5,748,703 N90S probably benign Het
Zfp715 A T 7: 43,299,884 Y217* probably null Het
Zfp9 T C 6: 118,464,886 T272A probably damaging Het
Zfp943 T A 17: 21,993,380 H482Q probably damaging Het
Zfp971 A T 2: 178,033,380 K257N probably benign Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10533060 missense probably benign 0.13
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8331:Greb1l UTSW 18 10458706 missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
R8695:Greb1l UTSW 18 10544450 missense probably benign 0.01
R8795:Greb1l UTSW 18 10553739 missense probably damaging 0.98
R8836:Greb1l UTSW 18 10509257 missense probably benign 0.30
R8862:Greb1l UTSW 18 10555042 missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10529684 missense probably benign 0.18
R8874:Greb1l UTSW 18 10544896 missense probably benign 0.01
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAACATTAGCTTTCCCCATTTCAG -3'
(R):5'- TGGAGACCTGCACTTTCCTG -3'

Sequencing Primer
(F):5'- CCCATTTCAGGGTTTTCTGGAAATTG -3'
(R):5'- GCTTCACTTAATTATAAGAAGGGGC -3'
Posted On2020-09-15