Incidental Mutation 'R0014:Dmbx1'
ID64866
Institutional Source Beutler Lab
Gene Symbol Dmbx1
Ensembl Gene ENSMUSG00000028707
Gene Namediencephalon/mesencephalon homeobox 1
SynonymsAtx, Cdmx, Dmbx1, Mbx, Otx3
MMRRC Submission 038309-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.820) question?
Stock #R0014 (G1)
Quality Score168
Status Validated
Chromosome4
Chromosomal Location115915119-115939926 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 115918024 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 358 (T358K)
Ref Sequence ENSEMBL: ENSMUSP00000081366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064806] [ENSMUST00000084338] [ENSMUST00000124071]
Predicted Effect probably damaging
Transcript: ENSMUST00000064806
AA Change: T353K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134457
Gene: ENSMUSG00000028707
AA Change: T353K

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HOX 66 128 6.07e-26 SMART
low complexity region 172 187 N/A INTRINSIC
low complexity region 235 256 N/A INTRINSIC
low complexity region 284 295 N/A INTRINSIC
low complexity region 330 348 N/A INTRINSIC
Pfam:OAR 349 368 9.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084338
AA Change: T358K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081366
Gene: ENSMUSG00000028707
AA Change: T358K

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HOX 71 133 6.07e-26 SMART
low complexity region 177 192 N/A INTRINSIC
low complexity region 240 261 N/A INTRINSIC
low complexity region 289 300 N/A INTRINSIC
low complexity region 335 353 N/A INTRINSIC
Pfam:OAR 355 372 3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124071
AA Change: T353K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120320
Gene: ENSMUSG00000028707
AA Change: T353K

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HOX 66 128 6.07e-26 SMART
low complexity region 172 187 N/A INTRINSIC
low complexity region 235 256 N/A INTRINSIC
low complexity region 284 295 N/A INTRINSIC
low complexity region 330 348 N/A INTRINSIC
Pfam:OAR 349 368 9.2e-9 PFAM
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bicoid sub-family of homeodomain-containing transcription factors. The encoded protein acts as a transcription factor and may play a role in brain and sensory organ development. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one null allele display partial postnatal lethality, impaired suckling and postnatal growth, and reduced female fertility. When raised in isolation, mice homozygous for another null allele exhibit decreased body weight, decreased food consumption, and small adipocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik T C 1: 181,055,131 F153L possibly damaging Het
A1bg T A 15: 60,919,732 D92V probably damaging Het
Ankrd52 C A 10: 128,386,452 T583K probably benign Het
C3ar1 C T 6: 122,850,851 V136M probably damaging Het
Capg A G 6: 72,561,043 E304G possibly damaging Het
Ccdc125 A C 13: 100,684,338 N189T possibly damaging Het
Ccr5 T C 9: 124,124,621 F87S probably damaging Het
Cd2ap T C 17: 42,807,928 S540G probably benign Het
Cdt1 C T 8: 122,572,566 T529M probably benign Het
Cfap126 A G 1: 171,125,784 D49G possibly damaging Het
Cngb3 T C 4: 19,396,685 I346T probably benign Het
Dgkd A G 1: 87,881,881 D97G probably damaging Het
Dgkg A T 16: 22,565,364 probably null Het
Epc2 A T 2: 49,522,525 K172* probably null Het
F2rl2 A T 13: 95,700,909 N154I probably damaging Het
Fyttd1 G A 16: 32,905,554 R175Q probably damaging Het
Gbp5 T A 3: 142,506,735 C395S probably damaging Het
Gen1 T C 12: 11,241,641 N716D probably benign Het
Helz2 A G 2: 181,240,511 L163P probably damaging Het
Hmox2 T A 16: 4,765,033 L210Q probably damaging Het
Klhl28 T C 12: 64,957,302 T146A probably benign Het
Lrrk2 T C 15: 91,802,045 probably benign Het
Man2c1 T A 9: 57,139,701 M580K probably benign Het
Neb G A 2: 52,287,156 A1391V probably damaging Het
Nyap2 T C 1: 81,241,951 S563P probably damaging Het
Olfr1301 A G 2: 111,754,774 D175G probably damaging Het
Olfr520 T C 7: 99,736,049 V302A probably damaging Het
Olfr543 A G 7: 102,477,477 I131T probably damaging Het
P2rx5 T A 11: 73,167,062 probably benign Het
Pclo C T 5: 14,680,451 probably benign Het
Pex1 G A 5: 3,626,141 probably benign Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Psma8 A G 18: 14,726,530 I86V possibly damaging Het
Ptpdc1 G T 13: 48,586,919 Y345* probably null Het
Rcbtb1 G T 14: 59,235,242 K493N probably benign Het
Rexo2 A T 9: 48,474,447 S126T probably benign Het
Rorc T A 3: 94,377,613 probably benign Het
Slc7a2 T C 8: 40,911,028 L426P probably damaging Het
Syde1 T C 10: 78,590,034 T100A probably benign Het
Tbc1d20 A T 2: 152,311,781 Q342L probably benign Het
Thbs1 A G 2: 118,113,350 T150A possibly damaging Het
Trpm1 A G 7: 64,248,222 H317R probably damaging Het
Tut1 T A 19: 8,962,447 L265Q possibly damaging Het
Wdfy4 A G 14: 33,107,173 F1029L possibly damaging Het
Wdr63 T C 3: 146,081,423 probably null Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp458 A G 13: 67,258,090 V95A possibly damaging Het
Zscan18 A T 7: 12,769,417 F738L possibly damaging Het
Other mutations in Dmbx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Dmbx1 APN 4 115920006 missense probably benign 0.00
IGL02850:Dmbx1 APN 4 115918007 missense probably damaging 1.00
R0014:Dmbx1 UTSW 4 115918024 missense probably damaging 0.99
R0267:Dmbx1 UTSW 4 115918112 missense probably benign 0.41
R1164:Dmbx1 UTSW 4 115918258 missense probably damaging 1.00
R2567:Dmbx1 UTSW 4 115920292 missense probably damaging 1.00
R3419:Dmbx1 UTSW 4 115920676 missense probably benign 0.21
R5383:Dmbx1 UTSW 4 115918145 missense probably damaging 1.00
R5882:Dmbx1 UTSW 4 115920301 missense probably damaging 1.00
R5999:Dmbx1 UTSW 4 115918176 missense probably damaging 0.98
R7064:Dmbx1 UTSW 4 115918268 missense probably damaging 1.00
R7483:Dmbx1 UTSW 4 115923711 missense probably damaging 1.00
R7829:Dmbx1 UTSW 4 115923907 intron probably benign
Predicted Primers PCR Primer
(F):5'- ATTCCACACTTCAACTTACTAACGGGG -3'
(R):5'- ACAACCTGATGCACTACTCGTCTTTTG -3'

Sequencing Primer
(F):5'- ATCCCTGGGCTCTCAAAGTTAG -3'
(R):5'- ACTACTCGTCTTTTGAAGTGGGC -3'
Posted On2013-08-06