Incidental Mutation 'R7935:Slc6a13'
ID 648675
Institutional Source Beutler Lab
Gene Symbol Slc6a13
Ensembl Gene ENSMUSG00000030108
Gene Name solute carrier family 6 (neurotransmitter transporter, GABA), member 13
Synonyms Gabt3, Gat2
MMRRC Submission 045981-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.738) question?
Stock # R7935 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 121277247-121314680 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 121311450 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 369 (L369V)
Ref Sequence ENSEMBL: ENSMUSP00000066779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064580]
AlphaFold P31649
Predicted Effect possibly damaging
Transcript: ENSMUST00000064580
AA Change: L369V

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000066779
Gene: ENSMUSG00000030108
AA Change: L369V

DomainStartEndE-ValueType
Pfam:SNF 32 556 6.2e-252 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced taurine levels in the liver and increased taurine levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A G 9: 4,308,732 (GRCm39) V124A probably benign Het
Abca4 A G 3: 121,904,186 (GRCm39) M746V possibly damaging Het
Aldh18a1 G T 19: 40,562,226 (GRCm39) S266* probably null Het
Aldh1b1 C A 4: 45,802,968 (GRCm39) H169N probably benign Het
Anpep A G 7: 79,476,709 (GRCm39) I756T possibly damaging Het
Asb16 A T 11: 102,168,739 (GRCm39) E405V probably benign Het
B4galnt1 T A 10: 127,007,490 (GRCm39) F464I probably damaging Het
Bpifb5 A G 2: 154,070,975 (GRCm39) I225V probably benign Het
Brox T C 1: 183,062,484 (GRCm39) E290G probably damaging Het
Cacna1s T A 1: 136,020,333 (GRCm39) V790D possibly damaging Het
Cacng6 G T 7: 3,473,384 (GRCm39) K69N possibly damaging Het
Catsperg1 A G 7: 28,895,344 (GRCm39) I503T possibly damaging Het
Cdcp3 A G 7: 130,852,205 (GRCm39) N814D probably damaging Het
Celsr3 A C 9: 108,706,840 (GRCm39) M1108L probably benign Het
Chd2 T C 7: 73,149,373 (GRCm39) N449S probably benign Het
Cpne6 T C 14: 55,750,066 (GRCm39) C66R possibly damaging Het
Ctnna2 T C 6: 76,919,270 (GRCm39) E656G probably damaging Het
Dnah17 A T 11: 118,018,048 (GRCm39) M149K probably benign Het
Dpp8 A T 9: 64,944,262 (GRCm39) M10L possibly damaging Het
Dst T C 1: 34,329,486 (GRCm39) L4838P probably damaging Het
Eif4g3 T A 4: 137,824,082 (GRCm39) I55N probably damaging Het
Gm10750 A G 2: 148,858,017 (GRCm39) L78P unknown Het
Gulo T G 14: 66,237,288 (GRCm39) K200Q probably benign Het
Jmjd8 T A 17: 26,048,071 (GRCm39) L56Q probably benign Het
Kansl1 G T 11: 104,315,112 (GRCm39) Q309K probably damaging Het
Kcns3 A C 12: 11,141,718 (GRCm39) L327R probably damaging Het
Mapk10 A G 5: 103,139,792 (GRCm39) I153T possibly damaging Het
Muc5b G T 7: 141,400,569 (GRCm39) M513I unknown Het
Nbea A G 3: 55,966,086 (GRCm39) F459L probably damaging Het
Nrcam G A 12: 44,631,644 (GRCm39) V1066I possibly damaging Het
Numa1 A G 7: 101,651,538 (GRCm39) K178E probably damaging Het
Or4b1 C T 2: 89,979,928 (GRCm39) V141M probably benign Het
Or5au1 T C 14: 52,272,645 (GRCm39) K308E probably benign Het
Or5d14 G A 2: 87,880,290 (GRCm39) T226M probably damaging Het
Pabpc4 C T 4: 123,191,837 (GRCm39) A649V probably benign Het
Parp12 C A 6: 39,079,612 (GRCm39) K299N possibly damaging Het
Pcdhga7 A G 18: 37,849,562 (GRCm39) D523G possibly damaging Het
Polr2a T C 11: 69,638,330 (GRCm39) T79A probably benign Het
Ppp1r7 T C 1: 93,273,904 (GRCm39) S27P probably damaging Het
Pramel42 G T 5: 94,685,440 (GRCm39) D367Y probably damaging Het
Prol1 T G 5: 88,475,874 (GRCm39) L88R probably damaging Het
Ptpn6 T C 6: 124,709,425 (GRCm39) Q57R possibly damaging Het
Rdh16 A G 10: 127,637,334 (GRCm39) I90V probably benign Het
Rock2 T A 12: 16,998,558 (GRCm39) C275S probably damaging Het
Rp1l1 G T 14: 64,268,674 (GRCm39) R1420L probably damaging Het
Sav1 A G 12: 70,033,481 (GRCm39) Y21H probably damaging Het
Sec24a T C 11: 51,612,749 (GRCm39) N536S probably benign Het
Serpina9 A C 12: 103,964,421 (GRCm39) F339V probably damaging Het
Smarcd3 A T 5: 24,801,024 (GRCm39) F128I probably damaging Het
Smok2a A T 17: 13,444,599 (GRCm39) I59F probably damaging Het
Spaca9 A G 2: 28,583,634 (GRCm39) probably null Het
Ssx2ip A T 3: 146,124,928 (GRCm39) E84D probably benign Het
Syt12 A T 19: 4,497,830 (GRCm39) V384E probably benign Het
Ticrr T A 7: 79,331,584 (GRCm39) L727Q probably damaging Het
Tmem170b A G 13: 41,781,463 (GRCm39) Y36C probably damaging Het
Tpd52l1 T C 10: 31,214,201 (GRCm39) T161A probably damaging Het
Zan T A 5: 137,461,841 (GRCm39) T1113S unknown Het
Zfp512b T C 2: 181,231,689 (GRCm39) T164A probably damaging Het
Zfp521 G A 18: 13,977,549 (GRCm39) P955S probably damaging Het
Zfp770 C T 2: 114,027,305 (GRCm39) V255I probably benign Het
Zfp942 A T 17: 22,148,208 (GRCm39) C140* probably null Het
Other mutations in Slc6a13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Slc6a13 APN 6 121,298,600 (GRCm39) missense probably damaging 1.00
IGL01947:Slc6a13 APN 6 121,302,116 (GRCm39) critical splice donor site probably null
IGL01969:Slc6a13 APN 6 121,312,601 (GRCm39) missense probably damaging 1.00
IGL02546:Slc6a13 APN 6 121,310,323 (GRCm39) missense probably benign
IGL02988:Slc6a13 APN 6 121,303,066 (GRCm39) unclassified probably benign
IGL03093:Slc6a13 APN 6 121,309,407 (GRCm39) missense probably damaging 1.00
IGL03358:Slc6a13 APN 6 121,311,495 (GRCm39) missense probably benign
IGL03384:Slc6a13 APN 6 121,309,350 (GRCm39) missense probably damaging 1.00
ANU74:Slc6a13 UTSW 6 121,311,835 (GRCm39) missense probably benign 0.42
R0217:Slc6a13 UTSW 6 121,301,279 (GRCm39) missense probably damaging 0.99
R0230:Slc6a13 UTSW 6 121,301,262 (GRCm39) missense probably benign 0.03
R0744:Slc6a13 UTSW 6 121,279,826 (GRCm39) missense probably damaging 1.00
R1546:Slc6a13 UTSW 6 121,309,333 (GRCm39) missense possibly damaging 0.78
R1604:Slc6a13 UTSW 6 121,309,328 (GRCm39) missense probably benign 0.02
R1654:Slc6a13 UTSW 6 121,313,885 (GRCm39) missense probably benign
R1781:Slc6a13 UTSW 6 121,311,811 (GRCm39) missense probably damaging 0.99
R1978:Slc6a13 UTSW 6 121,309,332 (GRCm39) missense probably damaging 1.00
R2130:Slc6a13 UTSW 6 121,302,000 (GRCm39) missense possibly damaging 0.77
R4570:Slc6a13 UTSW 6 121,313,101 (GRCm39) critical splice donor site probably null
R4623:Slc6a13 UTSW 6 121,302,104 (GRCm39) missense probably damaging 0.99
R4755:Slc6a13 UTSW 6 121,302,008 (GRCm39) missense probably damaging 1.00
R5068:Slc6a13 UTSW 6 121,310,301 (GRCm39) missense probably damaging 0.99
R5485:Slc6a13 UTSW 6 121,313,032 (GRCm39) missense probably damaging 1.00
R5687:Slc6a13 UTSW 6 121,279,700 (GRCm39) missense probably benign 0.00
R6045:Slc6a13 UTSW 6 121,298,587 (GRCm39) missense probably damaging 1.00
R6235:Slc6a13 UTSW 6 121,279,753 (GRCm39) missense probably benign 0.02
R6338:Slc6a13 UTSW 6 121,311,798 (GRCm39) missense probably damaging 0.96
R6393:Slc6a13 UTSW 6 121,313,801 (GRCm39) missense possibly damaging 0.83
R6844:Slc6a13 UTSW 6 121,302,012 (GRCm39) missense probably damaging 0.99
R7379:Slc6a13 UTSW 6 121,313,798 (GRCm39) nonsense probably null
R7734:Slc6a13 UTSW 6 121,314,334 (GRCm39) missense probably benign 0.00
R7800:Slc6a13 UTSW 6 121,298,658 (GRCm39) missense probably damaging 0.98
R7862:Slc6a13 UTSW 6 121,312,589 (GRCm39) missense probably damaging 1.00
R8177:Slc6a13 UTSW 6 121,301,987 (GRCm39) nonsense probably null
R8324:Slc6a13 UTSW 6 121,314,373 (GRCm39) makesense probably null
R8457:Slc6a13 UTSW 6 121,303,063 (GRCm39) splice site probably null
R8992:Slc6a13 UTSW 6 121,313,901 (GRCm39) nonsense probably null
R8995:Slc6a13 UTSW 6 121,302,012 (GRCm39) missense probably damaging 1.00
R9104:Slc6a13 UTSW 6 121,313,044 (GRCm39) missense probably benign
R9168:Slc6a13 UTSW 6 121,302,042 (GRCm39) missense probably damaging 1.00
R9235:Slc6a13 UTSW 6 121,301,984 (GRCm39) missense probably damaging 0.98
R9242:Slc6a13 UTSW 6 121,295,228 (GRCm39) missense probably damaging 0.99
RF020:Slc6a13 UTSW 6 121,301,310 (GRCm39) critical splice donor site probably null
Z1177:Slc6a13 UTSW 6 121,311,462 (GRCm39) missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CAAGTAGAAGCTTGGGTGGC -3'
(R):5'- TCCCTTGAAAGGCATCCAC -3'

Sequencing Primer
(F):5'- TCAGGATGATCAAGTTATCAGGTG -3'
(R):5'- TTGAAAGGCATCCACCCAGTC -3'
Posted On 2020-09-15