Incidental Mutation 'R0014:C3ar1'
ID64868
Institutional Source Beutler Lab
Gene Symbol C3ar1
Ensembl Gene ENSMUSG00000040552
Gene Namecomplement component 3a receptor 1
SynonymsC3aR, anaphylatoxin C3a receptor
MMRRC Submission 038309-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0014 (G1)
Quality Score121
Status Validated
Chromosome6
Chromosomal Location122847138-122856161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 122850851 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 136 (V136M)
Ref Sequence ENSEMBL: ENSMUSP00000048092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042081]
Predicted Effect probably damaging
Transcript: ENSMUST00000042081
AA Change: V136M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048092
Gene: ENSMUSG00000040552
AA Change: V136M

DomainStartEndE-ValueType
Pfam:7tm_1 40 193 8.1e-25 PFAM
Pfam:7TM_GPCR_Srsx 281 443 7.8e-8 PFAM
Pfam:7tm_1 313 428 6.5e-17 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C3a is an anaphylatoxin released during activation of the complement system. The protein encoded by this gene is an orphan G protein-coupled receptor for C3a. Binding of C3a by the encoded receptor activates chemotaxis, granule enzyme release, superoxide anion production, and bacterial opsonization. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous targeted mutants display protective effects against the changes in lung physiology after allergen challenge, increased lethality to endotoxin shock, and elevated IL1B following LPS challenge, supporting the role of C3arin proinflammatory responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik T C 1: 181,055,131 F153L possibly damaging Het
A1bg T A 15: 60,919,732 D92V probably damaging Het
Ankrd52 C A 10: 128,386,452 T583K probably benign Het
Capg A G 6: 72,561,043 E304G possibly damaging Het
Ccdc125 A C 13: 100,684,338 N189T possibly damaging Het
Ccr5 T C 9: 124,124,621 F87S probably damaging Het
Cd2ap T C 17: 42,807,928 S540G probably benign Het
Cdt1 C T 8: 122,572,566 T529M probably benign Het
Cfap126 A G 1: 171,125,784 D49G possibly damaging Het
Cngb3 T C 4: 19,396,685 I346T probably benign Het
Dgkd A G 1: 87,881,881 D97G probably damaging Het
Dgkg A T 16: 22,565,364 probably null Het
Dmbx1 G T 4: 115,918,024 T358K probably damaging Het
Epc2 A T 2: 49,522,525 K172* probably null Het
F2rl2 A T 13: 95,700,909 N154I probably damaging Het
Fyttd1 G A 16: 32,905,554 R175Q probably damaging Het
Gbp5 T A 3: 142,506,735 C395S probably damaging Het
Gen1 T C 12: 11,241,641 N716D probably benign Het
Helz2 A G 2: 181,240,511 L163P probably damaging Het
Hmox2 T A 16: 4,765,033 L210Q probably damaging Het
Klhl28 T C 12: 64,957,302 T146A probably benign Het
Lrrk2 T C 15: 91,802,045 probably benign Het
Man2c1 T A 9: 57,139,701 M580K probably benign Het
Neb G A 2: 52,287,156 A1391V probably damaging Het
Nyap2 T C 1: 81,241,951 S563P probably damaging Het
Olfr1301 A G 2: 111,754,774 D175G probably damaging Het
Olfr520 T C 7: 99,736,049 V302A probably damaging Het
Olfr543 A G 7: 102,477,477 I131T probably damaging Het
P2rx5 T A 11: 73,167,062 probably benign Het
Pclo C T 5: 14,680,451 probably benign Het
Pex1 G A 5: 3,626,141 probably benign Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Psma8 A G 18: 14,726,530 I86V possibly damaging Het
Ptpdc1 G T 13: 48,586,919 Y345* probably null Het
Rcbtb1 G T 14: 59,235,242 K493N probably benign Het
Rexo2 A T 9: 48,474,447 S126T probably benign Het
Rorc T A 3: 94,377,613 probably benign Het
Slc7a2 T C 8: 40,911,028 L426P probably damaging Het
Syde1 T C 10: 78,590,034 T100A probably benign Het
Tbc1d20 A T 2: 152,311,781 Q342L probably benign Het
Thbs1 A G 2: 118,113,350 T150A possibly damaging Het
Trpm1 A G 7: 64,248,222 H317R probably damaging Het
Tut1 T A 19: 8,962,447 L265Q possibly damaging Het
Wdfy4 A G 14: 33,107,173 F1029L possibly damaging Het
Wdr63 T C 3: 146,081,423 probably null Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp458 A G 13: 67,258,090 V95A possibly damaging Het
Zscan18 A T 7: 12,769,417 F738L possibly damaging Het
Other mutations in C3ar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:C3ar1 APN 6 122850419 missense probably benign 0.00
IGL01936:C3ar1 APN 6 122851235 missense probably benign 0.04
IGL01998:C3ar1 APN 6 122850940 missense probably damaging 1.00
IGL02351:C3ar1 APN 6 122849975 missense probably damaging 1.00
IGL02358:C3ar1 APN 6 122849975 missense probably damaging 1.00
IGL02399:C3ar1 APN 6 122849879 missense probably benign 0.00
PIT4618001:C3ar1 UTSW 6 122850787 missense probably benign 0.25
R0195:C3ar1 UTSW 6 122851155 missense possibly damaging 0.95
R0257:C3ar1 UTSW 6 122850787 missense probably benign 0.25
R0344:C3ar1 UTSW 6 122850772 missense probably benign 0.45
R4345:C3ar1 UTSW 6 122850700 missense probably damaging 1.00
R4614:C3ar1 UTSW 6 122850721 missense probably benign 0.00
R4643:C3ar1 UTSW 6 122850974 missense probably damaging 1.00
R4840:C3ar1 UTSW 6 122850764 missense probably benign
R5235:C3ar1 UTSW 6 122850922 missense probably damaging 1.00
R5303:C3ar1 UTSW 6 122849835 missense probably damaging 1.00
R5610:C3ar1 UTSW 6 122850578 missense probably benign 0.01
R5762:C3ar1 UTSW 6 122850362 missense probably benign 0.07
R5873:C3ar1 UTSW 6 122850422 missense probably benign 0.24
R5877:C3ar1 UTSW 6 122850622 missense probably benign 0.17
R6327:C3ar1 UTSW 6 122850146 missense probably damaging 1.00
R6440:C3ar1 UTSW 6 122850508 missense probably damaging 0.99
R6505:C3ar1 UTSW 6 122850640 missense probably benign 0.03
R6636:C3ar1 UTSW 6 122851054 missense probably damaging 1.00
R6755:C3ar1 UTSW 6 122849858 missense probably benign 0.00
R6953:C3ar1 UTSW 6 122850632 missense possibly damaging 0.49
R8049:C3ar1 UTSW 6 122850100 missense probably damaging 0.97
X0065:C3ar1 UTSW 6 122850765 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGGAAGGAGCTGACCTGTCATTC -3'
(R):5'- GCTCACCTGATTCTCCAAGGACAC -3'

Sequencing Primer
(F):5'- GACCTGTCATTCATATGTCCAGTTAG -3'
(R):5'- ACACTGGCCCTATGGCTTG -3'
Posted On2013-08-06