Incidental Mutation 'R7935:Ticrr'
ID648680
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene NameTOPBP1-interacting checkpoint and replication regulator
Synonyms5730590G19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R7935 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location79660196-79698148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79681836 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 727 (L727Q)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
Predicted Effect probably damaging
Transcript: ENSMUST00000035977
AA Change: L727Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: L727Q

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
Predicted Effect probably damaging
Transcript: ENSMUST00000206591
AA Change: L727Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,250,476 N814D probably damaging Het
Aasdhppt A G 9: 4,308,732 V124A probably benign Het
Abca4 A G 3: 122,110,537 M746V possibly damaging Het
Aldh18a1 G T 19: 40,573,782 S266* probably null Het
Aldh1b1 C A 4: 45,802,968 H169N probably benign Het
Anpep A G 7: 79,826,961 I756T possibly damaging Het
Asb16 A T 11: 102,277,913 E405V probably benign Het
B4galnt1 T A 10: 127,171,621 F464I probably damaging Het
Bpifb5 A G 2: 154,229,055 I225V probably benign Het
Brox T C 1: 183,280,920 E290G probably damaging Het
Cacna1s T A 1: 136,092,595 V790D possibly damaging Het
Cacng6 G T 7: 3,424,868 K69N possibly damaging Het
Catsperg1 A G 7: 29,195,919 I503T possibly damaging Het
Celsr3 A C 9: 108,829,641 M1108L probably benign Het
Chd2 T C 7: 73,499,625 N449S probably benign Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Ctnna2 T C 6: 76,942,287 E656G probably damaging Het
Dnah17 A T 11: 118,127,222 M149K probably benign Het
Dpp8 A T 9: 65,036,980 M10L possibly damaging Het
Dst T C 1: 34,290,405 L4838P probably damaging Het
Eif4g3 T A 4: 138,096,771 I55N probably damaging Het
Gm10750 A G 2: 149,016,097 L78P unknown Het
Gm3139 G T 5: 94,537,581 D367Y probably damaging Het
Gulo T G 14: 65,999,839 K200Q probably benign Het
Jmjd8 T A 17: 25,829,097 L56Q probably benign Het
Kansl1 G T 11: 104,424,286 Q309K probably damaging Het
Kcns3 A C 12: 11,091,717 L327R probably damaging Het
Mapk10 A G 5: 102,991,926 I153T possibly damaging Het
Muc5b G T 7: 141,846,832 M513I unknown Het
Nbea A G 3: 56,058,665 F459L probably damaging Het
Nrcam G A 12: 44,584,861 V1066I possibly damaging Het
Numa1 A G 7: 102,002,331 K178E probably damaging Het
Olfr1162 G A 2: 88,049,946 T226M probably damaging Het
Olfr1270 C T 2: 90,149,584 V141M probably benign Het
Olfr221 T C 14: 52,035,188 K308E probably benign Het
Pabpc4 C T 4: 123,298,044 A649V probably benign Het
Parp12 C A 6: 39,102,678 K299N possibly damaging Het
Pcdhga7 A G 18: 37,716,509 D523G possibly damaging Het
Polr2a T C 11: 69,747,504 T79A probably benign Het
Ppp1r7 T C 1: 93,346,182 S27P probably damaging Het
Prol1 T G 5: 88,328,015 L88R probably damaging Het
Ptpn6 T C 6: 124,732,462 Q57R possibly damaging Het
Rdh16 A G 10: 127,801,465 I90V probably benign Het
Rock2 T A 12: 16,948,557 C275S probably damaging Het
Rp1l1 G T 14: 64,031,225 R1420L probably damaging Het
Sav1 A G 12: 69,986,707 Y21H probably damaging Het
Sec24a T C 11: 51,721,922 N536S probably benign Het
Serpina9 A C 12: 103,998,162 F339V probably damaging Het
Slc6a13 T G 6: 121,334,491 L369V possibly damaging Het
Smarcd3 A T 5: 24,596,026 F128I probably damaging Het
Smok2a A T 17: 13,225,712 I59F probably damaging Het
Spaca9 A G 2: 28,693,622 probably null Het
Ssx2ip A T 3: 146,419,173 E84D probably benign Het
Syt12 A T 19: 4,447,802 V384E probably benign Het
Tmem170b A G 13: 41,627,987 Y36C probably damaging Het
Tpd52l1 T C 10: 31,338,205 T161A probably damaging Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp512b T C 2: 181,589,896 T164A probably damaging Het
Zfp521 G A 18: 13,844,492 P955S probably damaging Het
Zfp770 C T 2: 114,196,824 V255I probably benign Het
Zfp942 A T 17: 21,929,227 C140* probably null Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79677283 missense probably damaging 1.00
IGL00596:Ticrr APN 7 79677293 missense probably damaging 1.00
IGL01327:Ticrr APN 7 79694461 missense probably benign 0.00
IGL01525:Ticrr APN 7 79682449 missense probably damaging 1.00
IGL01565:Ticrr APN 7 79694548 missense probably benign
IGL01936:Ticrr APN 7 79694549 missense probably benign 0.11
IGL02160:Ticrr APN 7 79694019 missense probably benign 0.29
IGL02246:Ticrr APN 7 79675328 missense probably damaging 1.00
IGL02487:Ticrr APN 7 79683021 missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79695466 missense probably damaging 0.99
IGL02970:Ticrr APN 7 79695171 missense probably benign 0.01
FR4304:Ticrr UTSW 7 79694311 intron probably benign
PIT4305001:Ticrr UTSW 7 79679023 missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79669638 missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79693792 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0362:Ticrr UTSW 7 79677340 missense probably damaging 1.00
R0482:Ticrr UTSW 7 79694488 missense probably damaging 0.99
R0595:Ticrr UTSW 7 79695563 missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1119:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1572:Ticrr UTSW 7 79681824 missense probably damaging 1.00
R1658:Ticrr UTSW 7 79695549 missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79675323 missense probably damaging 0.99
R1757:Ticrr UTSW 7 79679046 nonsense probably null
R1862:Ticrr UTSW 7 79695207 missense probably damaging 1.00
R1869:Ticrr UTSW 7 79679135 missense probably damaging 1.00
R1938:Ticrr UTSW 7 79675394 missense probably damaging 0.98
R1966:Ticrr UTSW 7 79694735 nonsense probably null
R2006:Ticrr UTSW 7 79694073 missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79665685 missense probably benign 0.12
R3404:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3405:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3941:Ticrr UTSW 7 79693697 intron probably benign
R3950:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3951:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3952:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R4967:Ticrr UTSW 7 79660410 missense probably damaging 0.99
R4972:Ticrr UTSW 7 79669668 missense probably damaging 0.98
R5259:Ticrr UTSW 7 79694723 missense probably benign 0.01
R5272:Ticrr UTSW 7 79669605 missense probably benign 0.44
R5374:Ticrr UTSW 7 79690942 nonsense probably null
R5480:Ticrr UTSW 7 79660809 missense probably damaging 1.00
R5568:Ticrr UTSW 7 79689967 critical splice donor site probably null
R5568:Ticrr UTSW 7 79695296 nonsense probably null
R5588:Ticrr UTSW 7 79679105 missense probably damaging 1.00
R5698:Ticrr UTSW 7 79679133 missense probably benign
R5879:Ticrr UTSW 7 79696690 missense probably benign 0.12
R5980:Ticrr UTSW 7 79660955 missense probably damaging 0.99
R6128:Ticrr UTSW 7 79693968 missense probably damaging 1.00
R6277:Ticrr UTSW 7 79694696 missense probably benign 0.00
R6335:Ticrr UTSW 7 79694283 splice site probably null
R6866:Ticrr UTSW 7 79693957 missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79665850 missense probably benign 0.00
R6923:Ticrr UTSW 7 79691853 missense probably damaging 0.98
R6962:Ticrr UTSW 7 79665897 missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79693742 missense probably damaging 0.96
R7285:Ticrr UTSW 7 79660862 missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79691849 missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79693986 missense probably benign
R7583:Ticrr UTSW 7 79696739 nonsense probably null
R7749:Ticrr UTSW 7 79679096 missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79682012 missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79669485 missense probably benign 0.23
R8005:Ticrr UTSW 7 79694048 missense probably damaging 0.98
R8080:Ticrr UTSW 7 79684264 splice site probably null
R8181:Ticrr UTSW 7 79660980 missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79694680 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AAACCCTGGATTCCTTCCCT -3'
(R):5'- GCAGCAAATCTGTCACCTGA -3'

Sequencing Primer
(F):5'- CAAGACAGGGTTTCTCTGTATAGCC -3'
(R):5'- TCTGTCACCTGAAAGAGATTGC -3'
Posted On2020-09-15