Incidental Mutation 'R7935:Tpd52l1'
ID648688
Institutional Source Beutler Lab
Gene Symbol Tpd52l1
Ensembl Gene ENSMUSG00000000296
Gene Nametumor protein D52-like 1
SynonymsD53
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7935 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location31332376-31445958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31338205 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 161 (T161A)
Ref Sequence ENSEMBL: ENSMUSP00000149177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000305] [ENSMUST00000213528] [ENSMUST00000213639] [ENSMUST00000214644] [ENSMUST00000215515]
Predicted Effect probably damaging
Transcript: ENSMUST00000000305
AA Change: T156A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000305
Gene: ENSMUSG00000000296
AA Change: T156A

DomainStartEndE-ValueType
Pfam:TPD52 9 187 1.3e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213528
AA Change: T161A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213639
AA Change: T143A

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000214644
Predicted Effect probably benign
Transcript: ENSMUST00000215515
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain coiled-coil domains and may form hetero- or homomers. The encoded protein is involved in cell proliferation and calcium signaling. It also interacts with the mitogen-activated protein kinase kinase kinase 5 (MAP3K5/ASK1) and positively regulates MAP3K5-induced apoptosis. Multiple alternatively spliced transcript variants have been observed. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,250,476 N814D probably damaging Het
Aasdhppt A G 9: 4,308,732 V124A probably benign Het
Abca4 A G 3: 122,110,537 M746V possibly damaging Het
Aldh18a1 G T 19: 40,573,782 S266* probably null Het
Aldh1b1 C A 4: 45,802,968 H169N probably benign Het
Anpep A G 7: 79,826,961 I756T possibly damaging Het
Asb16 A T 11: 102,277,913 E405V probably benign Het
B4galnt1 T A 10: 127,171,621 F464I probably damaging Het
Bpifb5 A G 2: 154,229,055 I225V probably benign Het
Brox T C 1: 183,280,920 E290G probably damaging Het
Cacna1s T A 1: 136,092,595 V790D possibly damaging Het
Cacng6 G T 7: 3,424,868 K69N possibly damaging Het
Catsperg1 A G 7: 29,195,919 I503T possibly damaging Het
Celsr3 A C 9: 108,829,641 M1108L probably benign Het
Chd2 T C 7: 73,499,625 N449S probably benign Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Ctnna2 T C 6: 76,942,287 E656G probably damaging Het
Dnah17 A T 11: 118,127,222 M149K probably benign Het
Dpp8 A T 9: 65,036,980 M10L possibly damaging Het
Dst T C 1: 34,290,405 L4838P probably damaging Het
Eif4g3 T A 4: 138,096,771 I55N probably damaging Het
Gm10750 A G 2: 149,016,097 L78P unknown Het
Gm3139 G T 5: 94,537,581 D367Y probably damaging Het
Gulo T G 14: 65,999,839 K200Q probably benign Het
Jmjd8 T A 17: 25,829,097 L56Q probably benign Het
Kansl1 G T 11: 104,424,286 Q309K probably damaging Het
Kcns3 A C 12: 11,091,717 L327R probably damaging Het
Mapk10 A G 5: 102,991,926 I153T possibly damaging Het
Muc5b G T 7: 141,846,832 M513I unknown Het
Nbea A G 3: 56,058,665 F459L probably damaging Het
Nrcam G A 12: 44,584,861 V1066I possibly damaging Het
Numa1 A G 7: 102,002,331 K178E probably damaging Het
Olfr1162 G A 2: 88,049,946 T226M probably damaging Het
Olfr1270 C T 2: 90,149,584 V141M probably benign Het
Olfr221 T C 14: 52,035,188 K308E probably benign Het
Pabpc4 C T 4: 123,298,044 A649V probably benign Het
Parp12 C A 6: 39,102,678 K299N possibly damaging Het
Pcdhga7 A G 18: 37,716,509 D523G possibly damaging Het
Polr2a T C 11: 69,747,504 T79A probably benign Het
Ppp1r7 T C 1: 93,346,182 S27P probably damaging Het
Prol1 T G 5: 88,328,015 L88R probably damaging Het
Ptpn6 T C 6: 124,732,462 Q57R possibly damaging Het
Rdh16 A G 10: 127,801,465 I90V probably benign Het
Rock2 T A 12: 16,948,557 C275S probably damaging Het
Rp1l1 G T 14: 64,031,225 R1420L probably damaging Het
Sav1 A G 12: 69,986,707 Y21H probably damaging Het
Sec24a T C 11: 51,721,922 N536S probably benign Het
Serpina9 A C 12: 103,998,162 F339V probably damaging Het
Slc6a13 T G 6: 121,334,491 L369V possibly damaging Het
Smarcd3 A T 5: 24,596,026 F128I probably damaging Het
Smok2a A T 17: 13,225,712 I59F probably damaging Het
Spaca9 A G 2: 28,693,622 probably null Het
Ssx2ip A T 3: 146,419,173 E84D probably benign Het
Syt12 A T 19: 4,447,802 V384E probably benign Het
Ticrr T A 7: 79,681,836 L727Q probably damaging Het
Tmem170b A G 13: 41,627,987 Y36C probably damaging Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp512b T C 2: 181,589,896 T164A probably damaging Het
Zfp521 G A 18: 13,844,492 P955S probably damaging Het
Zfp770 C T 2: 114,196,824 V255I probably benign Het
Zfp942 A T 17: 21,929,227 C140* probably null Het
Other mutations in Tpd52l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0123:Tpd52l1 UTSW 10 31379256 missense probably damaging 1.00
R0134:Tpd52l1 UTSW 10 31379256 missense probably damaging 1.00
R0225:Tpd52l1 UTSW 10 31379256 missense probably damaging 1.00
R4411:Tpd52l1 UTSW 10 31379319 missense possibly damaging 0.88
R4828:Tpd52l1 UTSW 10 31346701 missense probably damaging 1.00
R5073:Tpd52l1 UTSW 10 31357920 missense probably damaging 1.00
R5925:Tpd52l1 UTSW 10 31332947 missense probably benign 0.18
R6332:Tpd52l1 UTSW 10 31338207 missense probably damaging 1.00
R6848:Tpd52l1 UTSW 10 31332857 missense probably benign 0.03
R6906:Tpd52l1 UTSW 10 31332954 missense possibly damaging 0.47
R7900:Tpd52l1 UTSW 10 31338182 splice site probably null
R8010:Tpd52l1 UTSW 10 31358013 missense possibly damaging 0.89
R8011:Tpd52l1 UTSW 10 31332917 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACTCTAAGGATGCAGGAAGACTC -3'
(R):5'- AGTTGGTCCAGGTCACAAGC -3'

Sequencing Primer
(F):5'- GTGGCTGCTGACTTTATCAATAGATC -3'
(R):5'- TCCAGGTCACAAGCCGAGAG -3'
Posted On2020-09-15