Incidental Mutation 'R0014:Olfr520'
ID64869
Institutional Source Beutler Lab
Gene Symbol Olfr520
Ensembl Gene ENSMUSG00000073998
Gene Nameolfactory receptor 520
SynonymsMOR101-1, GA_x6K02T2PBJ9-2411789-2412739
MMRRC Submission 038309-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R0014 (G1)
Quality Score104
Status Validated
Chromosome7
Chromosomal Location99730273-99736399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99736049 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 302 (V302A)
Ref Sequence ENSEMBL: ENSMUSP00000151459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098264] [ENSMUST00000220185]
Predicted Effect probably damaging
Transcript: ENSMUST00000098264
AA Change: V302A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095864
Gene: ENSMUSG00000073998
AA Change: V302A

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 1.2e-59 PFAM
Pfam:7tm_1 46 295 7.7e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207139
Predicted Effect probably damaging
Transcript: ENSMUST00000220185
AA Change: V302A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.2358 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik T C 1: 181,055,131 F153L possibly damaging Het
A1bg T A 15: 60,919,732 D92V probably damaging Het
Ankrd52 C A 10: 128,386,452 T583K probably benign Het
C3ar1 C T 6: 122,850,851 V136M probably damaging Het
Capg A G 6: 72,561,043 E304G possibly damaging Het
Ccdc125 A C 13: 100,684,338 N189T possibly damaging Het
Ccr5 T C 9: 124,124,621 F87S probably damaging Het
Cd2ap T C 17: 42,807,928 S540G probably benign Het
Cdt1 C T 8: 122,572,566 T529M probably benign Het
Cfap126 A G 1: 171,125,784 D49G possibly damaging Het
Cngb3 T C 4: 19,396,685 I346T probably benign Het
Dgkd A G 1: 87,881,881 D97G probably damaging Het
Dgkg A T 16: 22,565,364 probably null Het
Dmbx1 G T 4: 115,918,024 T358K probably damaging Het
Epc2 A T 2: 49,522,525 K172* probably null Het
F2rl2 A T 13: 95,700,909 N154I probably damaging Het
Fyttd1 G A 16: 32,905,554 R175Q probably damaging Het
Gbp5 T A 3: 142,506,735 C395S probably damaging Het
Gen1 T C 12: 11,241,641 N716D probably benign Het
Helz2 A G 2: 181,240,511 L163P probably damaging Het
Hmox2 T A 16: 4,765,033 L210Q probably damaging Het
Klhl28 T C 12: 64,957,302 T146A probably benign Het
Lrrk2 T C 15: 91,802,045 probably benign Het
Man2c1 T A 9: 57,139,701 M580K probably benign Het
Neb G A 2: 52,287,156 A1391V probably damaging Het
Nyap2 T C 1: 81,241,951 S563P probably damaging Het
Olfr1301 A G 2: 111,754,774 D175G probably damaging Het
Olfr543 A G 7: 102,477,477 I131T probably damaging Het
P2rx5 T A 11: 73,167,062 probably benign Het
Pclo C T 5: 14,680,451 probably benign Het
Pex1 G A 5: 3,626,141 probably benign Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Psma8 A G 18: 14,726,530 I86V possibly damaging Het
Ptpdc1 G T 13: 48,586,919 Y345* probably null Het
Rcbtb1 G T 14: 59,235,242 K493N probably benign Het
Rexo2 A T 9: 48,474,447 S126T probably benign Het
Rorc T A 3: 94,377,613 probably benign Het
Slc7a2 T C 8: 40,911,028 L426P probably damaging Het
Syde1 T C 10: 78,590,034 T100A probably benign Het
Tbc1d20 A T 2: 152,311,781 Q342L probably benign Het
Thbs1 A G 2: 118,113,350 T150A possibly damaging Het
Trpm1 A G 7: 64,248,222 H317R probably damaging Het
Tut1 T A 19: 8,962,447 L265Q possibly damaging Het
Wdfy4 A G 14: 33,107,173 F1029L possibly damaging Het
Wdr63 T C 3: 146,081,423 probably null Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp458 A G 13: 67,258,090 V95A possibly damaging Het
Zscan18 A T 7: 12,769,417 F738L possibly damaging Het
Other mutations in Olfr520
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Olfr520 APN 7 99735317 missense probably benign 0.00
IGL01745:Olfr520 APN 7 99735388 missense probably damaging 0.96
IGL01932:Olfr520 APN 7 99735500 missense probably damaging 0.99
IGL01987:Olfr520 APN 7 99735271 missense probably damaging 0.98
R0219:Olfr520 UTSW 7 99735928 missense probably benign 0.00
R1577:Olfr520 UTSW 7 99735356 missense probably damaging 1.00
R1931:Olfr520 UTSW 7 99735860 missense possibly damaging 0.73
R6110:Olfr520 UTSW 7 99735170 missense possibly damaging 0.93
R7723:Olfr520 UTSW 7 99735677 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGTTCTGACACTACTCCCCAGACG -3'
(R):5'- ATTCTACTCCGAGCACTGGACCAC -3'

Sequencing Primer
(F):5'- TGCTTCGGATCAACTCCAAGG -3'
(R):5'- AGCACTGGACCACTCTGAG -3'
Posted On2013-08-06