Incidental Mutation 'R7935:Serpina9'
ID 648700
Institutional Source Beutler Lab
Gene Symbol Serpina9
Ensembl Gene ENSMUSG00000058260
Gene Name serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9
Synonyms Centerin, 2310014L03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R7935 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 103994743-104013755 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 103998162 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 339 (F339V)
Ref Sequence ENSEMBL: ENSMUSP00000058535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058464]
AlphaFold Q9D7D2
Predicted Effect probably damaging
Transcript: ENSMUST00000058464
AA Change: F339V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058535
Gene: ENSMUSG00000058260
AA Change: F339V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 55 415 1.27e-158 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,250,476 N814D probably damaging Het
Aasdhppt A G 9: 4,308,732 V124A probably benign Het
Abca4 A G 3: 122,110,537 M746V possibly damaging Het
Aldh18a1 G T 19: 40,573,782 S266* probably null Het
Aldh1b1 C A 4: 45,802,968 H169N probably benign Het
Anpep A G 7: 79,826,961 I756T possibly damaging Het
Asb16 A T 11: 102,277,913 E405V probably benign Het
B4galnt1 T A 10: 127,171,621 F464I probably damaging Het
Bpifb5 A G 2: 154,229,055 I225V probably benign Het
Brox T C 1: 183,280,920 E290G probably damaging Het
Cacna1s T A 1: 136,092,595 V790D possibly damaging Het
Cacng6 G T 7: 3,424,868 K69N possibly damaging Het
Catsperg1 A G 7: 29,195,919 I503T possibly damaging Het
Celsr3 A C 9: 108,829,641 M1108L probably benign Het
Chd2 T C 7: 73,499,625 N449S probably benign Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Ctnna2 T C 6: 76,942,287 E656G probably damaging Het
Dnah17 A T 11: 118,127,222 M149K probably benign Het
Dpp8 A T 9: 65,036,980 M10L possibly damaging Het
Dst T C 1: 34,290,405 L4838P probably damaging Het
Eif4g3 T A 4: 138,096,771 I55N probably damaging Het
Gm10750 A G 2: 149,016,097 L78P unknown Het
Gm3139 G T 5: 94,537,581 D367Y probably damaging Het
Gulo T G 14: 65,999,839 K200Q probably benign Het
Jmjd8 T A 17: 25,829,097 L56Q probably benign Het
Kansl1 G T 11: 104,424,286 Q309K probably damaging Het
Kcns3 A C 12: 11,091,717 L327R probably damaging Het
Mapk10 A G 5: 102,991,926 I153T possibly damaging Het
Muc5b G T 7: 141,846,832 M513I unknown Het
Nbea A G 3: 56,058,665 F459L probably damaging Het
Nrcam G A 12: 44,584,861 V1066I possibly damaging Het
Numa1 A G 7: 102,002,331 K178E probably damaging Het
Olfr1162 G A 2: 88,049,946 T226M probably damaging Het
Olfr1270 C T 2: 90,149,584 V141M probably benign Het
Olfr221 T C 14: 52,035,188 K308E probably benign Het
Pabpc4 C T 4: 123,298,044 A649V probably benign Het
Parp12 C A 6: 39,102,678 K299N possibly damaging Het
Pcdhga7 A G 18: 37,716,509 D523G possibly damaging Het
Polr2a T C 11: 69,747,504 T79A probably benign Het
Ppp1r7 T C 1: 93,346,182 S27P probably damaging Het
Prol1 T G 5: 88,328,015 L88R probably damaging Het
Ptpn6 T C 6: 124,732,462 Q57R possibly damaging Het
Rdh16 A G 10: 127,801,465 I90V probably benign Het
Rock2 T A 12: 16,948,557 C275S probably damaging Het
Rp1l1 G T 14: 64,031,225 R1420L probably damaging Het
Sav1 A G 12: 69,986,707 Y21H probably damaging Het
Sec24a T C 11: 51,721,922 N536S probably benign Het
Slc6a13 T G 6: 121,334,491 L369V possibly damaging Het
Smarcd3 A T 5: 24,596,026 F128I probably damaging Het
Smok2a A T 17: 13,225,712 I59F probably damaging Het
Spaca9 A G 2: 28,693,622 probably null Het
Ssx2ip A T 3: 146,419,173 E84D probably benign Het
Syt12 A T 19: 4,447,802 V384E probably benign Het
Ticrr T A 7: 79,681,836 L727Q probably damaging Het
Tmem170b A G 13: 41,627,987 Y36C probably damaging Het
Tpd52l1 T C 10: 31,338,205 T161A probably damaging Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp512b T C 2: 181,589,896 T164A probably damaging Het
Zfp521 G A 18: 13,844,492 P955S probably damaging Het
Zfp770 C T 2: 114,196,824 V255I probably benign Het
Zfp942 A T 17: 21,929,227 C140* probably null Het
Other mutations in Serpina9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Serpina9 APN 12 104008586 missense probably damaging 1.00
IGL02228:Serpina9 APN 12 104008600 missense probably benign 0.02
IGL02692:Serpina9 APN 12 104008406 missense probably damaging 1.00
IGL03149:Serpina9 APN 12 104008610 nonsense probably null
IGL03134:Serpina9 UTSW 12 104001437 missense probably null 0.18
R0119:Serpina9 UTSW 12 104001470 missense probably benign 0.18
R0299:Serpina9 UTSW 12 104001470 missense probably benign 0.18
R0499:Serpina9 UTSW 12 104001470 missense probably benign 0.18
R1477:Serpina9 UTSW 12 103997103 missense possibly damaging 0.90
R1912:Serpina9 UTSW 12 104001249 missense probably damaging 1.00
R2142:Serpina9 UTSW 12 104008309 missense probably benign 0.04
R2221:Serpina9 UTSW 12 103998264 missense probably damaging 0.98
R2413:Serpina9 UTSW 12 104001226 critical splice donor site probably null
R3939:Serpina9 UTSW 12 104008892 start codon destroyed probably benign 0.01
R4515:Serpina9 UTSW 12 104001294 missense probably benign 0.14
R5242:Serpina9 UTSW 12 104008385 missense probably benign 0.09
R5589:Serpina9 UTSW 12 104001469 missense probably benign 0.00
R5900:Serpina9 UTSW 12 104008871 nonsense probably null
R6171:Serpina9 UTSW 12 104008419 nonsense probably null
R6195:Serpina9 UTSW 12 104001407 missense probably damaging 0.96
R6566:Serpina9 UTSW 12 103997037 missense possibly damaging 0.61
R6995:Serpina9 UTSW 12 104001236 missense probably damaging 1.00
R7762:Serpina9 UTSW 12 104001316 missense probably damaging 0.98
R7808:Serpina9 UTSW 12 104001225 critical splice donor site probably null
R7860:Serpina9 UTSW 12 104001421 missense probably benign 0.01
R9041:Serpina9 UTSW 12 104001478 missense
Z1176:Serpina9 UTSW 12 104001284 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAAGACTTGGCCTTTCC -3'
(R):5'- TCAGTGGACTTCTCTGGCAC -3'

Sequencing Primer
(F):5'- ACAAGACTTGGCCTTTCCTTTGG -3'
(R):5'- GGACTTCTCTGGCACTCAGTAACAG -3'
Posted On 2020-09-15