Incidental Mutation 'R0014:Cdt1'
ID64871
Institutional Source Beutler Lab
Gene Symbol Cdt1
Ensembl Gene ENSMUSG00000006585
Gene Namechromatin licensing and DNA replication factor 1
Synonyms2610318F11Rik, Ris2
MMRRC Submission 038309-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R0014 (G1)
Quality Score120
Status Validated
Chromosome8
Chromosomal Location122568015-122573554 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 122572566 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 529 (T529M)
Ref Sequence ENSEMBL: ENSMUSP00000006760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006760] [ENSMUST00000006764] [ENSMUST00000127664] [ENSMUST00000211823] [ENSMUST00000212093] [ENSMUST00000213029] [ENSMUST00000213062]
PDB Structure
Structure of the Cdt1 C-terminal domain [SOLUTION NMR]
Structure of C-terminal region of Cdt1 [SOLUTION NMR]
Crystal structure of Cdt1/geminin complex [X-RAY DIFFRACTION]
Crystal structure of cdt1 C terminal domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000006760
AA Change: T529M

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000006760
Gene: ENSMUSG00000006585
AA Change: T529M

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
low complexity region 59 70 N/A INTRINSIC
low complexity region 72 108 N/A INTRINSIC
CDT1 199 362 3.68e-91 SMART
low complexity region 401 427 N/A INTRINSIC
Pfam:CDT1_C 431 525 1.4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000006764
SMART Domains Protein: ENSMUSP00000006764
Gene: ENSMUSG00000006589

DomainStartEndE-ValueType
Pfam:Pribosyltran 28 178 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211810
Predicted Effect probably benign
Transcript: ENSMUST00000211823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212053
Predicted Effect probably benign
Transcript: ENSMUST00000212093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213017
Predicted Effect probably benign
Transcript: ENSMUST00000213029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213030
Predicted Effect probably benign
Transcript: ENSMUST00000213062
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the formation of the pre-replication complex that is necessary for DNA replication. The encoded protein can bind geminin, which prevents replication and may function to prevent this protein from initiating replication at inappropriate origins. Phosphorylation of this protein by cyclin A-dependent kinases results in degradation of the protein. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a small in-frame deletion in exon 2 are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik T C 1: 181,055,131 F153L possibly damaging Het
A1bg T A 15: 60,919,732 D92V probably damaging Het
Ankrd52 C A 10: 128,386,452 T583K probably benign Het
C3ar1 C T 6: 122,850,851 V136M probably damaging Het
Capg A G 6: 72,561,043 E304G possibly damaging Het
Ccdc125 A C 13: 100,684,338 N189T possibly damaging Het
Ccr5 T C 9: 124,124,621 F87S probably damaging Het
Cd2ap T C 17: 42,807,928 S540G probably benign Het
Cfap126 A G 1: 171,125,784 D49G possibly damaging Het
Cngb3 T C 4: 19,396,685 I346T probably benign Het
Dgkd A G 1: 87,881,881 D97G probably damaging Het
Dgkg A T 16: 22,565,364 probably null Het
Dmbx1 G T 4: 115,918,024 T358K probably damaging Het
Epc2 A T 2: 49,522,525 K172* probably null Het
F2rl2 A T 13: 95,700,909 N154I probably damaging Het
Fyttd1 G A 16: 32,905,554 R175Q probably damaging Het
Gbp5 T A 3: 142,506,735 C395S probably damaging Het
Gen1 T C 12: 11,241,641 N716D probably benign Het
Helz2 A G 2: 181,240,511 L163P probably damaging Het
Hmox2 T A 16: 4,765,033 L210Q probably damaging Het
Klhl28 T C 12: 64,957,302 T146A probably benign Het
Lrrk2 T C 15: 91,802,045 probably benign Het
Man2c1 T A 9: 57,139,701 M580K probably benign Het
Neb G A 2: 52,287,156 A1391V probably damaging Het
Nyap2 T C 1: 81,241,951 S563P probably damaging Het
Olfr1301 A G 2: 111,754,774 D175G probably damaging Het
Olfr520 T C 7: 99,736,049 V302A probably damaging Het
Olfr543 A G 7: 102,477,477 I131T probably damaging Het
P2rx5 T A 11: 73,167,062 probably benign Het
Pclo C T 5: 14,680,451 probably benign Het
Pex1 G A 5: 3,626,141 probably benign Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Psma8 A G 18: 14,726,530 I86V possibly damaging Het
Ptpdc1 G T 13: 48,586,919 Y345* probably null Het
Rcbtb1 G T 14: 59,235,242 K493N probably benign Het
Rexo2 A T 9: 48,474,447 S126T probably benign Het
Rorc T A 3: 94,377,613 probably benign Het
Slc7a2 T C 8: 40,911,028 L426P probably damaging Het
Syde1 T C 10: 78,590,034 T100A probably benign Het
Tbc1d20 A T 2: 152,311,781 Q342L probably benign Het
Thbs1 A G 2: 118,113,350 T150A possibly damaging Het
Trpm1 A G 7: 64,248,222 H317R probably damaging Het
Tut1 T A 19: 8,962,447 L265Q possibly damaging Het
Wdfy4 A G 14: 33,107,173 F1029L possibly damaging Het
Wdr63 T C 3: 146,081,423 probably null Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp458 A G 13: 67,258,090 V95A possibly damaging Het
Zscan18 A T 7: 12,769,417 F738L possibly damaging Het
Other mutations in Cdt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0494:Cdt1 UTSW 8 122572060 missense possibly damaging 0.64
R0614:Cdt1 UTSW 8 122568137 missense probably benign 0.04
R0645:Cdt1 UTSW 8 122572145 unclassified probably benign
R1699:Cdt1 UTSW 8 122569983 missense probably damaging 0.99
R1889:Cdt1 UTSW 8 122572052 missense possibly damaging 0.85
R3114:Cdt1 UTSW 8 122570482 nonsense probably null
R4243:Cdt1 UTSW 8 122571418 missense probably benign 0.04
R4532:Cdt1 UTSW 8 122571756 missense probably benign 0.00
R5496:Cdt1 UTSW 8 122570500 missense probably damaging 0.99
R5498:Cdt1 UTSW 8 122570500 missense probably damaging 0.99
R5501:Cdt1 UTSW 8 122570500 missense probably damaging 0.99
R5523:Cdt1 UTSW 8 122568093 missense possibly damaging 0.95
R5647:Cdt1 UTSW 8 122570208 missense possibly damaging 0.79
R6160:Cdt1 UTSW 8 122571368 missense probably benign 0.36
R6892:Cdt1 UTSW 8 122570212 missense probably damaging 1.00
R7001:Cdt1 UTSW 8 122572510 missense probably damaging 1.00
R7089:Cdt1 UTSW 8 122571980 missense probably damaging 1.00
R7214:Cdt1 UTSW 8 122568273 critical splice donor site probably null
R7583:Cdt1 UTSW 8 122570256 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGTTGCCAAACTGCTCTGAGTCC -3'
(R):5'- AGGCTTAAAGGCGTAAGTGCGTCG -3'

Sequencing Primer
(F):5'- GTCTATTTCTGACCAGGGACAG -3'
(R):5'- GCGTCGTGTACTGATGAAAG -3'
Posted On2013-08-06