Incidental Mutation 'R7936:Spata16'
ID648718
Institutional Source Beutler Lab
Gene Symbol Spata16
Ensembl Gene ENSMUSG00000039335
Gene Namespermatogenesis associated 16
Synonymsspermatogenesis-related protein, 4921511F01Rik, 4930503K02Rik, Nyd-sp12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R7936 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location26637620-26983212 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26667423 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 31 (M31K)
Ref Sequence ENSEMBL: ENSMUSP00000043378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047005] [ENSMUST00000108305]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047005
AA Change: M31K

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000043378
Gene: ENSMUSG00000039335
AA Change: M31K

DomainStartEndE-ValueType
Pfam:NYD-SP12_N 5 569 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108305
AA Change: M31K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103941
Gene: ENSMUSG00000039335
AA Change: M31K

DomainStartEndE-ValueType
Pfam:NYD-SP12_N 1 534 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a testis-specific protein that belongs to the tetratricopeptide repeat-like superfamily. The encoded protein localizes to the Golgi apparatus and may play a role in spermatogenesis. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T A 6: 91,923,464 L438* probably null Het
Adamts18 T A 8: 113,767,128 I460F probably damaging Het
Api5 C T 2: 94,438,047 probably benign Het
Arap2 A G 5: 62,730,705 S433P probably damaging Het
Arhgap26 T C 18: 39,205,287 Y371H probably damaging Het
Asf1b T C 8: 83,969,219 I163T probably benign Het
Cacna2d2 A G 9: 107,524,127 N696S probably damaging Het
Carns1 A C 19: 4,166,153 S677A probably benign Het
Cd276 G A 9: 58,540,830 probably benign Het
Cdk8 T A 5: 146,299,834 M353K possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Chsy3 A G 18: 59,409,346 I519V probably damaging Het
Chtop T C 3: 90,507,351 probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Col16a1 A T 4: 130,096,871 probably null Het
Dnah5 A G 15: 28,345,837 E2441G possibly damaging Het
Dpy19l2 T G 9: 24,558,158 D734A probably damaging Het
Dusp2 T A 2: 127,336,892 Y172* probably null Het
Eml4 G A 17: 83,473,686 R771Q possibly damaging Het
Fat2 T A 11: 55,310,167 M694L probably benign Het
Fat2 C A 11: 55,311,160 E363* probably null Het
Gdpgp1 A G 7: 80,239,078 I286V probably damaging Het
Gm11639 A G 11: 104,999,698 N4202S possibly damaging Het
Gm11639 G A 11: 105,046,559 probably null Het
Gps1 T A 11: 120,786,373 V166E probably damaging Het
H60b T A 10: 22,286,156 N93K probably benign Het
Imp4 C T 1: 34,443,033 T79I probably benign Het
Kank3 A G 17: 33,818,867 S485G probably benign Het
Kcnv2 A G 19: 27,322,767 N6S probably benign Het
Krba1 A T 6: 48,411,669 Q534L probably damaging Het
Lgr4 A G 2: 110,006,518 N399S probably damaging Het
Lgr5 A G 10: 115,453,047 V564A probably damaging Het
Lrtm2 A G 6: 119,320,433 F216L probably benign Het
Lsm8 T A 6: 18,849,659 M22K probably benign Het
Mboat2 C T 12: 24,955,393 T389M probably damaging Het
Mcoln1 T G 8: 3,505,924 I73S probably damaging Het
Myh7 T A 14: 54,979,463 I1146F possibly damaging Het
Naa16 G A 14: 79,341,046 T666I possibly damaging Het
Ncoa1 A G 12: 4,335,873 S88P possibly damaging Het
Obscn T C 11: 59,050,508 T4496A possibly damaging Het
Olfr1351 T A 10: 79,018,038 F239I probably damaging Het
Olfr61 T C 7: 140,637,739 F13L probably damaging Het
Papd5 G A 8: 88,252,285 G505R probably null Het
Pdxk G T 10: 78,441,178 A262D possibly damaging Het
Pebp4 T A 14: 69,851,633 L68Q probably damaging Het
Pfdn5 C T 15: 102,328,543 H77Y possibly damaging Het
Pld1 T C 3: 28,076,502 Y484H probably damaging Het
Pou3f3 C A 1: 42,697,400 N85K unknown Het
Ppm1m C A 9: 106,197,945 A134S probably damaging Het
Prdm11 A T 2: 92,975,761 S281R possibly damaging Het
Prdm2 C A 4: 143,135,864 L285F probably damaging Het
Ptchd3 C T 11: 121,831,113 R271* probably null Het
Ptprq A C 10: 107,652,711 V955G probably damaging Het
Pygb A T 2: 150,815,669 M351L probably benign Het
Rcl1 G A 19: 29,118,405 probably null Het
Sgip1 A T 4: 102,928,900 T351S possibly damaging Het
Slc22a5 T C 11: 53,869,389 N367S probably damaging Het
Sox6 A G 7: 115,544,595 V437A probably benign Het
Stab1 C A 14: 31,157,415 V703F possibly damaging Het
Tbc1d4 C T 14: 101,465,754 G752R probably damaging Het
Tes3-ps C T 13: 49,493,984 A112V probably benign Het
Tnfrsf19 T C 14: 60,970,933 T380A probably benign Het
Trim75 C T 8: 64,982,538 G420E probably damaging Het
Txlnb A G 10: 17,827,964 D290G probably benign Het
Unc5c T A 3: 141,828,477 F920I possibly damaging Het
Vmn1r233 T A 17: 20,993,975 R238* probably null Het
Vmn2r113 A G 17: 22,957,943 E567G probably benign Het
Vmn2r97 T A 17: 18,930,400 I503K probably damaging Het
Wdr62 A G 7: 30,265,159 W387R probably damaging Het
Zfp36l2 A T 17: 84,187,662 D11E probably benign Het
Other mutations in Spata16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Spata16 APN 3 26924262 missense probably damaging 0.98
IGL01017:Spata16 APN 3 26840722 missense possibly damaging 0.93
IGL01129:Spata16 APN 3 26913184 splice site probably benign
IGL01330:Spata16 APN 3 26914715 missense probably damaging 0.99
IGL02033:Spata16 APN 3 26913334 critical splice donor site probably null
IGL02069:Spata16 APN 3 26732795 nonsense probably null
IGL02231:Spata16 APN 3 26913264 missense probably damaging 1.00
R0084:Spata16 UTSW 3 26667410 missense possibly damaging 0.95
R0109:Spata16 UTSW 3 26913267 missense probably damaging 0.97
R0109:Spata16 UTSW 3 26913267 missense probably damaging 0.97
R0325:Spata16 UTSW 3 26667456 missense probably damaging 0.98
R0811:Spata16 UTSW 3 26913338 splice site probably benign
R2061:Spata16 UTSW 3 26924370 missense probably damaging 0.99
R3148:Spata16 UTSW 3 26878712 critical splice donor site probably null
R4837:Spata16 UTSW 3 26732932 missense possibly damaging 0.93
R4972:Spata16 UTSW 3 26840723 missense possibly damaging 0.93
R5129:Spata16 UTSW 3 26667564 missense probably damaging 0.98
R5235:Spata16 UTSW 3 26667632 missense probably benign 0.00
R5458:Spata16 UTSW 3 26777537 missense probably damaging 0.99
R6578:Spata16 UTSW 3 26667548 nonsense probably null
R7069:Spata16 UTSW 3 26927334 missense probably damaging 0.99
R7256:Spata16 UTSW 3 26667867 missense probably benign 0.25
R8015:Spata16 UTSW 3 26667659 missense probably benign
R8060:Spata16 UTSW 3 26840720 missense probably damaging 0.99
R8161:Spata16 UTSW 3 26840662 missense probably benign 0.16
R8459:Spata16 UTSW 3 26667527 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCTGTGTTCTGCATGATAGC -3'
(R):5'- GTCAGCCTTCCGTTTAAGGG -3'

Sequencing Primer
(F):5'- CTGACTATTGGCTAAAACAACTGGG -3'
(R):5'- TTCCGTTTAAGGGCCACC -3'
Posted On2020-09-15