Mutagenetix > Incidental Mutations

Incidental Mutation 'R7936:Unc5c'

648721

Institutional Source

Beutler Lab

Gene Symbol

Unc5c

Ensembl Gene

ENSMUSG00000059921

Gene Name

unc-5 netrin receptor C

Synonyms

B130051O18Rik, Unc5h3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7936 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

141465216-141834924 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 141828477 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 920 (F920I)

Ref Sequence

ENSEMBL: ENSMUSP00000074758 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075282] [ENSMUST00000106236] [ENSMUST00000130636] [ENSMUST00000142762]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075282
AA Change: F920I

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000074758
Gene: ENSMUSG00000059921
AA Change: F920I

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
SCOP:d2fcba2	64	164	9e-3	SMART
IGc2	179	246	2.72e-5	SMART
TSP1	263	314	8.54e-13	SMART
TSP1	319	368	1.18e-6	SMART
transmembrane domain	396	418	N/A	INTRINSIC
ZU5	547	650	6.92e-63	SMART
low complexity region	695	704	N/A	INTRINSIC
DEATH	857	948	6.68e-24	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106236
AA Change: F901I

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000101843
Gene: ENSMUSG00000059921
AA Change: F901I

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
SCOP:d2fcba2	64	164	9e-3	SMART
IGc2	179	246	2.72e-5	SMART
TSP1	263	314	8.54e-13	SMART
TSP1	319	368	1.18e-6	SMART
transmembrane domain	377	399	N/A	INTRINSIC
ZU5	528	631	6.92e-63	SMART
low complexity region	676	685	N/A	INTRINSIC
DEATH	838	929	6.68e-24	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000130636
AA Change: F846I

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000117487
Gene: ENSMUSG00000059921
AA Change: F846I

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
IGc2	105	172	2.72e-5	SMART
TSP1	189	240	8.54e-13	SMART
TSP1	245	294	1.18e-6	SMART
transmembrane domain	322	344	N/A	INTRINSIC
ZU5	473	576	6.92e-63	SMART
low complexity region	621	630	N/A	INTRINSIC
DEATH	783	874	6.68e-24	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000142762
AA Change: F920I

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000118212
Gene: ENSMUSG00000059921
AA Change: F920I

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
SCOP:d2fcba2	64	164	9e-3	SMART
IGc2	179	246	2.72e-5	SMART
TSP1	263	314	8.54e-13	SMART
TSP1	319	368	1.18e-6	SMART
transmembrane domain	396	418	N/A	INTRINSIC
ZU5	547	650	6.92e-63	SMART
low complexity region	695	704	N/A	INTRINSIC
DEATH	857	948	6.68e-24	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the UNC-5 family of netrin receptors. Netrins are secreted proteins that direct axon extension and cell migration during neural development. They are bifunctional proteins that act as attractants for some cell types and as repellents for others, and these opposite actions are thought to be mediated by two classes of receptors. The UNC-5 family of receptors mediate the repellent response to netrin; they are transmembrane proteins containing 2 immunoglobulin (Ig)-like domains and 2 type I thrombospondin motifs in the extracellular region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants exhibit ataxia, and reduced size early in life. Mutants exhibit cerebellar defects including reduced size and ectopic cerebellar cells in the midbrain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	T	A	6: 91,923,464	L438*	probably null	Het
Adamts18	T	A	8: 113,767,128	I460F	probably damaging	Het
Api5	C	T	2: 94,438,047		probably benign	Het
Arap2	A	G	5: 62,730,705	S433P	probably damaging	Het
Arhgap26	T	C	18: 39,205,287	Y371H	probably damaging	Het
Asf1b	T	C	8: 83,969,219	I163T	probably benign	Het
Cacna2d2	A	G	9: 107,524,127	N696S	probably damaging	Het
Carns1	A	C	19: 4,166,153	S677A	probably benign	Het
Cd276	G	A	9: 58,540,830		probably benign	Het
Cdk8	T	A	5: 146,299,834	M353K	possibly damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Chsy3	A	G	18: 59,409,346	I519V	probably damaging	Het
Chtop	T	C	3: 90,507,351		probably benign	Het
Clstn3	T	A	6: 124,432,013	D892V	possibly damaging	Het
Col16a1	A	T	4: 130,096,871		probably null	Het
Dnah5	A	G	15: 28,345,837	E2441G	possibly damaging	Het
Dpy19l2	T	G	9: 24,558,158	D734A	probably damaging	Het
Dusp2	T	A	2: 127,336,892	Y172*	probably null	Het
Eml4	G	A	17: 83,473,686	R771Q	possibly damaging	Het
Fat2	C	A	11: 55,311,160	E363*	probably null	Het
Fat2	T	A	11: 55,310,167	M694L	probably benign	Het
Gdpgp1	A	G	7: 80,239,078	I286V	probably damaging	Het
Gm11639	A	G	11: 104,999,698	N4202S	possibly damaging	Het
Gm11639	G	A	11: 105,046,559		probably null	Het
Gps1	T	A	11: 120,786,373	V166E	probably damaging	Het
H60b	T	A	10: 22,286,156	N93K	probably benign	Het
Imp4	C	T	1: 34,443,033	T79I	probably benign	Het
Kank3	A	G	17: 33,818,867	S485G	probably benign	Het
Kcnv2	A	G	19: 27,322,767	N6S	probably benign	Het
Krba1	A	T	6: 48,411,669	Q534L	probably damaging	Het
Lgr4	A	G	2: 110,006,518	N399S	probably damaging	Het
Lgr5	A	G	10: 115,453,047	V564A	probably damaging	Het
Lrtm2	A	G	6: 119,320,433	F216L	probably benign	Het
Lsm8	T	A	6: 18,849,659	M22K	probably benign	Het
Mboat2	C	T	12: 24,955,393	T389M	probably damaging	Het
Mcoln1	T	G	8: 3,505,924	I73S	probably damaging	Het
Myh7	T	A	14: 54,979,463	I1146F	possibly damaging	Het
Naa16	G	A	14: 79,341,046	T666I	possibly damaging	Het
Ncoa1	A	G	12: 4,335,873	S88P	possibly damaging	Het
Obscn	T	C	11: 59,050,508	T4496A	possibly damaging	Het
Olfr1351	T	A	10: 79,018,038	F239I	probably damaging	Het
Olfr61	T	C	7: 140,637,739	F13L	probably damaging	Het
Papd5	G	A	8: 88,252,285	G505R	probably null	Het
Pdxk	G	T	10: 78,441,178	A262D	possibly damaging	Het
Pebp4	T	A	14: 69,851,633	L68Q	probably damaging	Het
Pfdn5	C	T	15: 102,328,543	H77Y	possibly damaging	Het
Pld1	T	C	3: 28,076,502	Y484H	probably damaging	Het
Pou3f3	C	A	1: 42,697,400	N85K	unknown	Het
Ppm1m	C	A	9: 106,197,945	A134S	probably damaging	Het
Prdm11	A	T	2: 92,975,761	S281R	possibly damaging	Het
Prdm2	C	A	4: 143,135,864	L285F	probably damaging	Het
Ptchd3	C	T	11: 121,831,113	R271*	probably null	Het
Ptprq	A	C	10: 107,652,711	V955G	probably damaging	Het
Pygb	A	T	2: 150,815,669	M351L	probably benign	Het
Rcl1	G	A	19: 29,118,405		probably null	Het
Sgip1	A	T	4: 102,928,900	T351S	possibly damaging	Het
Slc22a5	T	C	11: 53,869,389	N367S	probably damaging	Het
Sox6	A	G	7: 115,544,595	V437A	probably benign	Het
Spata16	T	A	3: 26,667,423	M31K	possibly damaging	Het
Stab1	C	A	14: 31,157,415	V703F	possibly damaging	Het
Tbc1d4	C	T	14: 101,465,754	G752R	probably damaging	Het
Tes3-ps	C	T	13: 49,493,984	A112V	probably benign	Het
Tnfrsf19	T	C	14: 60,970,933	T380A	probably benign	Het
Trim75	C	T	8: 64,982,538	G420E	probably damaging	Het
Txlnb	A	G	10: 17,827,964	D290G	probably benign	Het
Vmn1r233	T	A	17: 20,993,975	R238*	probably null	Het
Vmn2r113	A	G	17: 22,957,943	E567G	probably benign	Het
Vmn2r97	T	A	17: 18,930,400	I503K	probably damaging	Het
Wdr62	A	G	7: 30,265,159	W387R	probably damaging	Het
Zfp36l2	A	T	17: 84,187,662	D11E	probably benign	Het

Other mutations in Unc5c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Unc5c	APN	3	141788940	missense	probably damaging	0.99
IGL01089:Unc5c	APN	3	141818202	splice site	probably benign
IGL01478:Unc5c	APN	3	141828451	missense	probably damaging	1.00
IGL02083:Unc5c	APN	3	141714647	missense	probably damaging	0.99
IGL02269:Unc5c	APN	3	141788982	missense	probably damaging	1.00
IGL02565:Unc5c	APN	3	141803919	missense	probably damaging	1.00
IGL02973:Unc5c	APN	3	141788890	missense	probably benign	0.12
R0179:Unc5c	UTSW	3	141818067	nonsense	probably null
R0309:Unc5c	UTSW	3	141733933	missense	probably benign	0.01
R0371:Unc5c	UTSW	3	141827522	missense	probably benign	0.01
R0603:Unc5c	UTSW	3	141771102	missense	probably damaging	1.00
R0904:Unc5c	UTSW	3	141803840	missense	probably benign	0.08
R0907:Unc5c	UTSW	3	141789033	missense	probably damaging	0.99
R1300:Unc5c	UTSW	3	141828543	missense	possibly damaging	0.94
R1491:Unc5c	UTSW	3	141789822	missense	probably damaging	1.00
R1494:Unc5c	UTSW	3	141827549	missense	possibly damaging	0.93
R1674:Unc5c	UTSW	3	141757837	missense	possibly damaging	0.74
R1676:Unc5c	UTSW	3	141757837	missense	possibly damaging	0.74
R1726:Unc5c	UTSW	3	141818103	missense	probably damaging	1.00
R1750:Unc5c	UTSW	3	141827517	missense	possibly damaging	0.89
R1815:Unc5c	UTSW	3	141757757	missense	probably damaging	1.00
R2381:Unc5c	UTSW	3	141678155	missense	probably damaging	1.00
R2394:Unc5c	UTSW	3	141678131	missense	probably damaging	1.00
R2945:Unc5c	UTSW	3	141789974	missense	probably damaging	0.97
R4284:Unc5c	UTSW	3	141714674	missense	probably damaging	1.00
R4285:Unc5c	UTSW	3	141714674	missense	probably damaging	1.00
R4287:Unc5c	UTSW	3	141714674	missense	probably damaging	1.00
R4681:Unc5c	UTSW	3	141768613	critical splice donor site	probably null
R4736:Unc5c	UTSW	3	141816931	missense	probably benign	0.00
R4740:Unc5c	UTSW	3	141816931	missense	probably benign	0.00
R4774:Unc5c	UTSW	3	141828517	missense	probably damaging	1.00
R4862:Unc5c	UTSW	3	141789773	missense	probably damaging	1.00
R4905:Unc5c	UTSW	3	141801310	missense	probably benign	0.19
R4921:Unc5c	UTSW	3	141788966	missense	probably damaging	1.00
R5150:Unc5c	UTSW	3	141757793	missense	probably damaging	1.00
R5559:Unc5c	UTSW	3	141803787	missense	probably damaging	1.00
R5562:Unc5c	UTSW	3	141768530	missense	probably damaging	1.00
R5643:Unc5c	UTSW	3	141678125	missense	probably damaging	1.00
R5644:Unc5c	UTSW	3	141678125	missense	probably damaging	1.00
R5775:Unc5c	UTSW	3	141828520	missense	probably damaging	1.00
R5912:Unc5c	UTSW	3	141789006	missense	probably damaging	1.00
R6154:Unc5c	UTSW	3	141678153	missense	probably damaging	0.97
R6547:Unc5c	UTSW	3	141790019	missense	probably benign	0.16
R6558:Unc5c	UTSW	3	141789729	missense	probably damaging	0.98
R7104:Unc5c	UTSW	3	141733904	missense	probably damaging	1.00
R7113:Unc5c	UTSW	3	141801293	missense	probably benign	0.00
R7282:Unc5c	UTSW	3	141677990	missense	probably damaging	0.98
R7317:Unc5c	UTSW	3	141789942	missense	probably benign	0.00
R7787:Unc5c	UTSW	3	141768552	missense	probably damaging	1.00
R7873:Unc5c	UTSW	3	141827549	missense	probably benign	0.04
R7896:Unc5c	UTSW	3	141771161	missense	possibly damaging	0.73
R8041:Unc5c	UTSW	3	141465784	missense	possibly damaging	0.92
R8277:Unc5c	UTSW	3	141768612	critical splice donor site	probably null
R8669:Unc5c	UTSW	3	141803943	missense	possibly damaging	0.91
X0018:Unc5c	UTSW	3	141714739	missense	probably damaging	1.00
X0065:Unc5c	UTSW	3	141827661	missense	probably damaging	1.00
Z1088:Unc5c	UTSW	3	141733900	missense	probably damaging	1.00
Z1176:Unc5c	UTSW	3	141678010	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCCACGGTAGGACTGAAATGC -3'
(R):5'- TGCCATCTTGCCTGTAGAGC -3'

Sequencing Primer
(F):5'- CTTCAAGACAGACAGGTTTAGTGCC -3'
(R):5'- GTAGAGCGCCTTGGTCCTATC -3'

Posted On

2020-09-15