Incidental Mutation 'R7936:Unc5c'
ID648721
Institutional Source Beutler Lab
Gene Symbol Unc5c
Ensembl Gene ENSMUSG00000059921
Gene Nameunc-5 netrin receptor C
SynonymsB130051O18Rik, Unc5h3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7936 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location141465216-141834924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141828477 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 920 (F920I)
Ref Sequence ENSEMBL: ENSMUSP00000074758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075282] [ENSMUST00000106236] [ENSMUST00000130636] [ENSMUST00000142762]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075282
AA Change: F920I

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074758
Gene: ENSMUSG00000059921
AA Change: F920I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106236
AA Change: F901I

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101843
Gene: ENSMUSG00000059921
AA Change: F901I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 377 399 N/A INTRINSIC
ZU5 528 631 6.92e-63 SMART
low complexity region 676 685 N/A INTRINSIC
DEATH 838 929 6.68e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000130636
AA Change: F846I

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117487
Gene: ENSMUSG00000059921
AA Change: F846I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IGc2 105 172 2.72e-5 SMART
TSP1 189 240 8.54e-13 SMART
TSP1 245 294 1.18e-6 SMART
transmembrane domain 322 344 N/A INTRINSIC
ZU5 473 576 6.92e-63 SMART
low complexity region 621 630 N/A INTRINSIC
DEATH 783 874 6.68e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142762
AA Change: F920I

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118212
Gene: ENSMUSG00000059921
AA Change: F920I

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the UNC-5 family of netrin receptors. Netrins are secreted proteins that direct axon extension and cell migration during neural development. They are bifunctional proteins that act as attractants for some cell types and as repellents for others, and these opposite actions are thought to be mediated by two classes of receptors. The UNC-5 family of receptors mediate the repellent response to netrin; they are transmembrane proteins containing 2 immunoglobulin (Ig)-like domains and 2 type I thrombospondin motifs in the extracellular region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants exhibit ataxia, and reduced size early in life. Mutants exhibit cerebellar defects including reduced size and ectopic cerebellar cells in the midbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T A 6: 91,923,464 L438* probably null Het
Adamts18 T A 8: 113,767,128 I460F probably damaging Het
Api5 C T 2: 94,438,047 probably benign Het
Arap2 A G 5: 62,730,705 S433P probably damaging Het
Arhgap26 T C 18: 39,205,287 Y371H probably damaging Het
Asf1b T C 8: 83,969,219 I163T probably benign Het
Cacna2d2 A G 9: 107,524,127 N696S probably damaging Het
Carns1 A C 19: 4,166,153 S677A probably benign Het
Cd276 G A 9: 58,540,830 probably benign Het
Cdk8 T A 5: 146,299,834 M353K possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Chsy3 A G 18: 59,409,346 I519V probably damaging Het
Chtop T C 3: 90,507,351 probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Col16a1 A T 4: 130,096,871 probably null Het
Dnah5 A G 15: 28,345,837 E2441G possibly damaging Het
Dpy19l2 T G 9: 24,558,158 D734A probably damaging Het
Dusp2 T A 2: 127,336,892 Y172* probably null Het
Eml4 G A 17: 83,473,686 R771Q possibly damaging Het
Fat2 C A 11: 55,311,160 E363* probably null Het
Fat2 T A 11: 55,310,167 M694L probably benign Het
Gdpgp1 A G 7: 80,239,078 I286V probably damaging Het
Gm11639 A G 11: 104,999,698 N4202S possibly damaging Het
Gm11639 G A 11: 105,046,559 probably null Het
Gps1 T A 11: 120,786,373 V166E probably damaging Het
H60b T A 10: 22,286,156 N93K probably benign Het
Imp4 C T 1: 34,443,033 T79I probably benign Het
Kank3 A G 17: 33,818,867 S485G probably benign Het
Kcnv2 A G 19: 27,322,767 N6S probably benign Het
Krba1 A T 6: 48,411,669 Q534L probably damaging Het
Lgr4 A G 2: 110,006,518 N399S probably damaging Het
Lgr5 A G 10: 115,453,047 V564A probably damaging Het
Lrtm2 A G 6: 119,320,433 F216L probably benign Het
Lsm8 T A 6: 18,849,659 M22K probably benign Het
Mboat2 C T 12: 24,955,393 T389M probably damaging Het
Mcoln1 T G 8: 3,505,924 I73S probably damaging Het
Myh7 T A 14: 54,979,463 I1146F possibly damaging Het
Naa16 G A 14: 79,341,046 T666I possibly damaging Het
Ncoa1 A G 12: 4,335,873 S88P possibly damaging Het
Obscn T C 11: 59,050,508 T4496A possibly damaging Het
Olfr1351 T A 10: 79,018,038 F239I probably damaging Het
Olfr61 T C 7: 140,637,739 F13L probably damaging Het
Papd5 G A 8: 88,252,285 G505R probably null Het
Pdxk G T 10: 78,441,178 A262D possibly damaging Het
Pebp4 T A 14: 69,851,633 L68Q probably damaging Het
Pfdn5 C T 15: 102,328,543 H77Y possibly damaging Het
Pld1 T C 3: 28,076,502 Y484H probably damaging Het
Pou3f3 C A 1: 42,697,400 N85K unknown Het
Ppm1m C A 9: 106,197,945 A134S probably damaging Het
Prdm11 A T 2: 92,975,761 S281R possibly damaging Het
Prdm2 C A 4: 143,135,864 L285F probably damaging Het
Ptchd3 C T 11: 121,831,113 R271* probably null Het
Ptprq A C 10: 107,652,711 V955G probably damaging Het
Pygb A T 2: 150,815,669 M351L probably benign Het
Rcl1 G A 19: 29,118,405 probably null Het
Sgip1 A T 4: 102,928,900 T351S possibly damaging Het
Slc22a5 T C 11: 53,869,389 N367S probably damaging Het
Sox6 A G 7: 115,544,595 V437A probably benign Het
Spata16 T A 3: 26,667,423 M31K possibly damaging Het
Stab1 C A 14: 31,157,415 V703F possibly damaging Het
Tbc1d4 C T 14: 101,465,754 G752R probably damaging Het
Tes3-ps C T 13: 49,493,984 A112V probably benign Het
Tnfrsf19 T C 14: 60,970,933 T380A probably benign Het
Trim75 C T 8: 64,982,538 G420E probably damaging Het
Txlnb A G 10: 17,827,964 D290G probably benign Het
Vmn1r233 T A 17: 20,993,975 R238* probably null Het
Vmn2r113 A G 17: 22,957,943 E567G probably benign Het
Vmn2r97 T A 17: 18,930,400 I503K probably damaging Het
Wdr62 A G 7: 30,265,159 W387R probably damaging Het
Zfp36l2 A T 17: 84,187,662 D11E probably benign Het
Other mutations in Unc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Unc5c APN 3 141788940 missense probably damaging 0.99
IGL01089:Unc5c APN 3 141818202 splice site probably benign
IGL01478:Unc5c APN 3 141828451 missense probably damaging 1.00
IGL02083:Unc5c APN 3 141714647 missense probably damaging 0.99
IGL02269:Unc5c APN 3 141788982 missense probably damaging 1.00
IGL02565:Unc5c APN 3 141803919 missense probably damaging 1.00
IGL02973:Unc5c APN 3 141788890 missense probably benign 0.12
R0179:Unc5c UTSW 3 141818067 nonsense probably null
R0309:Unc5c UTSW 3 141733933 missense probably benign 0.01
R0371:Unc5c UTSW 3 141827522 missense probably benign 0.01
R0603:Unc5c UTSW 3 141771102 missense probably damaging 1.00
R0904:Unc5c UTSW 3 141803840 missense probably benign 0.08
R0907:Unc5c UTSW 3 141789033 missense probably damaging 0.99
R1300:Unc5c UTSW 3 141828543 missense possibly damaging 0.94
R1491:Unc5c UTSW 3 141789822 missense probably damaging 1.00
R1494:Unc5c UTSW 3 141827549 missense possibly damaging 0.93
R1674:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1676:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1726:Unc5c UTSW 3 141818103 missense probably damaging 1.00
R1750:Unc5c UTSW 3 141827517 missense possibly damaging 0.89
R1815:Unc5c UTSW 3 141757757 missense probably damaging 1.00
R2381:Unc5c UTSW 3 141678155 missense probably damaging 1.00
R2394:Unc5c UTSW 3 141678131 missense probably damaging 1.00
R2945:Unc5c UTSW 3 141789974 missense probably damaging 0.97
R4284:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4285:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4287:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4681:Unc5c UTSW 3 141768613 critical splice donor site probably null
R4736:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4740:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4774:Unc5c UTSW 3 141828517 missense probably damaging 1.00
R4862:Unc5c UTSW 3 141789773 missense probably damaging 1.00
R4905:Unc5c UTSW 3 141801310 missense probably benign 0.19
R4921:Unc5c UTSW 3 141788966 missense probably damaging 1.00
R5150:Unc5c UTSW 3 141757793 missense probably damaging 1.00
R5559:Unc5c UTSW 3 141803787 missense probably damaging 1.00
R5562:Unc5c UTSW 3 141768530 missense probably damaging 1.00
R5643:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5644:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5775:Unc5c UTSW 3 141828520 missense probably damaging 1.00
R5912:Unc5c UTSW 3 141789006 missense probably damaging 1.00
R6154:Unc5c UTSW 3 141678153 missense probably damaging 0.97
R6547:Unc5c UTSW 3 141790019 missense probably benign 0.16
R6558:Unc5c UTSW 3 141789729 missense probably damaging 0.98
R7104:Unc5c UTSW 3 141733904 missense probably damaging 1.00
R7113:Unc5c UTSW 3 141801293 missense probably benign 0.00
R7282:Unc5c UTSW 3 141677990 missense probably damaging 0.98
R7317:Unc5c UTSW 3 141789942 missense probably benign 0.00
R7787:Unc5c UTSW 3 141768552 missense probably damaging 1.00
R7873:Unc5c UTSW 3 141827549 missense probably benign 0.04
R7896:Unc5c UTSW 3 141771161 missense possibly damaging 0.73
R8041:Unc5c UTSW 3 141465784 missense possibly damaging 0.92
R8277:Unc5c UTSW 3 141768612 critical splice donor site probably null
R8669:Unc5c UTSW 3 141803943 missense possibly damaging 0.91
X0018:Unc5c UTSW 3 141714739 missense probably damaging 1.00
X0065:Unc5c UTSW 3 141827661 missense probably damaging 1.00
Z1088:Unc5c UTSW 3 141733900 missense probably damaging 1.00
Z1176:Unc5c UTSW 3 141678010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCACGGTAGGACTGAAATGC -3'
(R):5'- TGCCATCTTGCCTGTAGAGC -3'

Sequencing Primer
(F):5'- CTTCAAGACAGACAGGTTTAGTGCC -3'
(R):5'- GTAGAGCGCCTTGGTCCTATC -3'
Posted On2020-09-15