Incidental Mutation 'R7936:Prdm2'
ID648725
Institutional Source Beutler Lab
Gene Symbol Prdm2
Ensembl Gene ENSMUSG00000057637
Gene NamePR domain containing 2, with ZNF domain
SynonymsKMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7936 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location143107391-143212995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 143135864 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 285 (L285F)
Ref Sequence ENSEMBL: ENSMUSP00000101404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105778]
Predicted Effect probably damaging
Transcript: ENSMUST00000105778
AA Change: L285F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: L285F

DomainStartEndE-ValueType
SET 29 146 2.79e-21 SMART
coiled coil region 254 293 N/A INTRINSIC
low complexity region 333 346 N/A INTRINSIC
ZnF_C2H2 356 378 2.95e-3 SMART
ZnF_C2H2 386 408 4.79e-3 SMART
ZnF_C2H2 477 500 4.17e-3 SMART
low complexity region 517 528 N/A INTRINSIC
low complexity region 653 669 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 726 744 N/A INTRINSIC
low complexity region 868 877 N/A INTRINSIC
low complexity region 931 951 N/A INTRINSIC
low complexity region 954 992 N/A INTRINSIC
low complexity region 1011 1032 N/A INTRINSIC
low complexity region 1035 1080 N/A INTRINSIC
ZnF_C2H2 1126 1148 3.52e-1 SMART
ZnF_C2H2 1154 1177 7.55e-1 SMART
ZnF_C2H2 1183 1206 4.72e-2 SMART
low complexity region 1239 1253 N/A INTRINSIC
ZnF_C2H2 1324 1344 5.12e1 SMART
low complexity region 1406 1423 N/A INTRINSIC
ZnF_C2H2 1446 1466 1.86e1 SMART
low complexity region 1475 1507 N/A INTRINSIC
low complexity region 1551 1568 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T A 6: 91,923,464 L438* probably null Het
Adamts18 T A 8: 113,767,128 I460F probably damaging Het
Api5 C T 2: 94,438,047 probably benign Het
Arap2 A G 5: 62,730,705 S433P probably damaging Het
Arhgap26 T C 18: 39,205,287 Y371H probably damaging Het
Asf1b T C 8: 83,969,219 I163T probably benign Het
Cacna2d2 A G 9: 107,524,127 N696S probably damaging Het
Carns1 A C 19: 4,166,153 S677A probably benign Het
Cd276 G A 9: 58,540,830 probably benign Het
Cdk8 T A 5: 146,299,834 M353K possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Chsy3 A G 18: 59,409,346 I519V probably damaging Het
Chtop T C 3: 90,507,351 probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Col16a1 A T 4: 130,096,871 probably null Het
Dnah5 A G 15: 28,345,837 E2441G possibly damaging Het
Dpy19l2 T G 9: 24,558,158 D734A probably damaging Het
Dusp2 T A 2: 127,336,892 Y172* probably null Het
Eml4 G A 17: 83,473,686 R771Q possibly damaging Het
Fat2 T A 11: 55,310,167 M694L probably benign Het
Fat2 C A 11: 55,311,160 E363* probably null Het
Gdpgp1 A G 7: 80,239,078 I286V probably damaging Het
Gm11639 A G 11: 104,999,698 N4202S possibly damaging Het
Gm11639 G A 11: 105,046,559 probably null Het
Gps1 T A 11: 120,786,373 V166E probably damaging Het
H60b T A 10: 22,286,156 N93K probably benign Het
Imp4 C T 1: 34,443,033 T79I probably benign Het
Kank3 A G 17: 33,818,867 S485G probably benign Het
Kcnv2 A G 19: 27,322,767 N6S probably benign Het
Krba1 A T 6: 48,411,669 Q534L probably damaging Het
Lgr4 A G 2: 110,006,518 N399S probably damaging Het
Lgr5 A G 10: 115,453,047 V564A probably damaging Het
Lrtm2 A G 6: 119,320,433 F216L probably benign Het
Lsm8 T A 6: 18,849,659 M22K probably benign Het
Mboat2 C T 12: 24,955,393 T389M probably damaging Het
Mcoln1 T G 8: 3,505,924 I73S probably damaging Het
Myh7 T A 14: 54,979,463 I1146F possibly damaging Het
Naa16 G A 14: 79,341,046 T666I possibly damaging Het
Ncoa1 A G 12: 4,335,873 S88P possibly damaging Het
Obscn T C 11: 59,050,508 T4496A possibly damaging Het
Olfr1351 T A 10: 79,018,038 F239I probably damaging Het
Olfr61 T C 7: 140,637,739 F13L probably damaging Het
Papd5 G A 8: 88,252,285 G505R probably null Het
Pdxk G T 10: 78,441,178 A262D possibly damaging Het
Pebp4 T A 14: 69,851,633 L68Q probably damaging Het
Pfdn5 C T 15: 102,328,543 H77Y possibly damaging Het
Pld1 T C 3: 28,076,502 Y484H probably damaging Het
Pou3f3 C A 1: 42,697,400 N85K unknown Het
Ppm1m C A 9: 106,197,945 A134S probably damaging Het
Prdm11 A T 2: 92,975,761 S281R possibly damaging Het
Ptchd3 C T 11: 121,831,113 R271* probably null Het
Ptprq A C 10: 107,652,711 V955G probably damaging Het
Pygb A T 2: 150,815,669 M351L probably benign Het
Rcl1 G A 19: 29,118,405 probably null Het
Sgip1 A T 4: 102,928,900 T351S possibly damaging Het
Slc22a5 T C 11: 53,869,389 N367S probably damaging Het
Sox6 A G 7: 115,544,595 V437A probably benign Het
Spata16 T A 3: 26,667,423 M31K possibly damaging Het
Stab1 C A 14: 31,157,415 V703F possibly damaging Het
Tbc1d4 C T 14: 101,465,754 G752R probably damaging Het
Tes3-ps C T 13: 49,493,984 A112V probably benign Het
Tnfrsf19 T C 14: 60,970,933 T380A probably benign Het
Trim75 C T 8: 64,982,538 G420E probably damaging Het
Txlnb A G 10: 17,827,964 D290G probably benign Het
Unc5c T A 3: 141,828,477 F920I possibly damaging Het
Vmn1r233 T A 17: 20,993,975 R238* probably null Het
Vmn2r113 A G 17: 22,957,943 E567G probably benign Het
Vmn2r97 T A 17: 18,930,400 I503K probably damaging Het
Wdr62 A G 7: 30,265,159 W387R probably damaging Het
Zfp36l2 A T 17: 84,187,662 D11E probably benign Het
Other mutations in Prdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Prdm2 APN 4 143133759 missense probably damaging 0.99
IGL00843:Prdm2 APN 4 143134314 missense probably damaging 1.00
IGL01419:Prdm2 APN 4 143133648 missense probably damaging 0.99
IGL01662:Prdm2 APN 4 143133568 missense possibly damaging 0.73
IGL01892:Prdm2 APN 4 143134404 missense probably damaging 1.00
IGL02104:Prdm2 APN 4 143133427 missense probably benign 0.01
IGL02208:Prdm2 APN 4 143135743 missense probably benign 0.01
IGL02260:Prdm2 APN 4 143134587 missense probably damaging 1.00
IGL02479:Prdm2 APN 4 143134929 missense probably damaging 1.00
IGL02943:Prdm2 APN 4 143131972 missense probably benign
IGL02972:Prdm2 APN 4 143132166 missense probably benign
IGL03038:Prdm2 APN 4 143134001 missense probably damaging 1.00
IGL03399:Prdm2 APN 4 143135088 missense probably benign 0.07
PIT4677001:Prdm2 UTSW 4 143135078 missense probably damaging 1.00
R0088:Prdm2 UTSW 4 143134954 missense possibly damaging 0.86
R0153:Prdm2 UTSW 4 143133768 missense possibly damaging 0.93
R0320:Prdm2 UTSW 4 143179351 missense probably damaging 1.00
R0384:Prdm2 UTSW 4 143135688 missense probably benign 0.01
R0400:Prdm2 UTSW 4 143111670 missense probably benign
R0658:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R0850:Prdm2 UTSW 4 143132203 missense possibly damaging 0.53
R1118:Prdm2 UTSW 4 143132383 missense possibly damaging 0.52
R1355:Prdm2 UTSW 4 143131963 missense probably benign 0.33
R1519:Prdm2 UTSW 4 143135583 missense probably damaging 1.00
R1936:Prdm2 UTSW 4 143134462 missense probably benign 0.00
R1987:Prdm2 UTSW 4 143132509 missense possibly damaging 0.73
R2006:Prdm2 UTSW 4 143131877 missense possibly damaging 0.73
R2008:Prdm2 UTSW 4 143134947 missense probably damaging 1.00
R2030:Prdm2 UTSW 4 143132764 missense possibly damaging 0.53
R2112:Prdm2 UTSW 4 143131936 missense probably benign
R2221:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2223:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2426:Prdm2 UTSW 4 143111750 nonsense probably null
R2430:Prdm2 UTSW 4 143133163 missense possibly damaging 0.73
R2484:Prdm2 UTSW 4 143135206 missense probably damaging 1.00
R3735:Prdm2 UTSW 4 143134359 missense probably damaging 1.00
R3944:Prdm2 UTSW 4 143131815 missense possibly damaging 0.53
R4209:Prdm2 UTSW 4 143134437 missense probably damaging 1.00
R4411:Prdm2 UTSW 4 143133670 missense probably benign 0.18
R4647:Prdm2 UTSW 4 143132955 missense possibly damaging 0.85
R4898:Prdm2 UTSW 4 143134191 missense probably damaging 1.00
R5032:Prdm2 UTSW 4 143179367 nonsense probably null
R5181:Prdm2 UTSW 4 143134966 missense probably benign 0.35
R5513:Prdm2 UTSW 4 143135893 small deletion probably benign
R5539:Prdm2 UTSW 4 143132694 missense possibly damaging 0.53
R5563:Prdm2 UTSW 4 143134630 missense probably benign 0.09
R5618:Prdm2 UTSW 4 143133537 missense probably benign 0.00
R5900:Prdm2 UTSW 4 143134720 missense probably damaging 1.00
R5990:Prdm2 UTSW 4 143170113 missense probably damaging 1.00
R6148:Prdm2 UTSW 4 143132907 missense probably benign 0.33
R6166:Prdm2 UTSW 4 143134736 missense probably damaging 0.99
R6223:Prdm2 UTSW 4 143142207 missense probably benign 0.41
R6530:Prdm2 UTSW 4 143134047 missense probably benign 0.05
R6631:Prdm2 UTSW 4 143134884 missense probably benign 0.05
R6725:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R6847:Prdm2 UTSW 4 143132950 missense probably benign 0.18
R7193:Prdm2 UTSW 4 143180894 missense probably damaging 1.00
R7238:Prdm2 UTSW 4 143135821 missense probably benign 0.35
R7292:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R7417:Prdm2 UTSW 4 143179299 missense probably damaging 1.00
R7748:Prdm2 UTSW 4 143135889 missense possibly damaging 0.89
R7885:Prdm2 UTSW 4 143134570 missense probably benign 0.41
R7976:Prdm2 UTSW 4 143133242 nonsense probably null
R8124:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R8150:Prdm2 UTSW 4 143132733 missense possibly damaging 0.73
R8156:Prdm2 UTSW 4 143134768 missense probably benign 0.01
R8178:Prdm2 UTSW 4 143132448 missense probably benign 0.33
R8235:Prdm2 UTSW 4 143132467 nonsense probably null
R8404:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
R8498:Prdm2 UTSW 4 143180897 missense probably damaging 1.00
R8502:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
X0017:Prdm2 UTSW 4 143134707 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCTTTCACAATGCTGACATGG -3'
(R):5'- TAAGCCAGGATGCAGTTCC -3'

Sequencing Primer
(F):5'- ACATGAATGTTTCAAGCCCCTCG -3'
(R):5'- CAGGATGCAGTTCCACAGGTG -3'
Posted On2020-09-15