Incidental Mutation 'R7936:Clstn3'
ID648732
Institutional Source Beutler Lab
Gene Symbol Clstn3
Ensembl Gene ENSMUSG00000008153
Gene Namecalsyntenin 3
Synonymsalcadein-beta, Cst-3, CSTN3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7936 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location124430759-124464794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124432013 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 892 (D892V)
Ref Sequence ENSEMBL: ENSMUSP00000008297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008297] [ENSMUST00000112523]
Predicted Effect possibly damaging
Transcript: ENSMUST00000008297
AA Change: D892V

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000008297
Gene: ENSMUSG00000008153
AA Change: D892V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CA 50 143 2.72e-12 SMART
CA 166 244 4.04e-2 SMART
SCOP:d1a8d_1 333 549 7e-23 SMART
transmembrane domain 846 868 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112523
AA Change: D855V

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108142
Gene: ENSMUSG00000008153
AA Change: D855V

DomainStartEndE-ValueType
CA 13 106 2.72e-12 SMART
CA 129 207 4.04e-2 SMART
Pfam:Laminin_G_3 304 505 4.1e-8 PFAM
transmembrane domain 809 831 N/A INTRINSIC
low complexity region 891 908 N/A INTRINSIC
Meta Mutation Damage Score 0.0998 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reductions in excitatory and inhibitory synapse density and deficits in synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T A 6: 91,923,464 L438* probably null Het
Adamts18 T A 8: 113,767,128 I460F probably damaging Het
Api5 C T 2: 94,438,047 probably benign Het
Arap2 A G 5: 62,730,705 S433P probably damaging Het
Arhgap26 T C 18: 39,205,287 Y371H probably damaging Het
Asf1b T C 8: 83,969,219 I163T probably benign Het
Cacna2d2 A G 9: 107,524,127 N696S probably damaging Het
Carns1 A C 19: 4,166,153 S677A probably benign Het
Cd276 G A 9: 58,540,830 probably benign Het
Cdk8 T A 5: 146,299,834 M353K possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Chsy3 A G 18: 59,409,346 I519V probably damaging Het
Chtop T C 3: 90,507,351 probably benign Het
Col16a1 A T 4: 130,096,871 probably null Het
Dnah5 A G 15: 28,345,837 E2441G possibly damaging Het
Dpy19l2 T G 9: 24,558,158 D734A probably damaging Het
Dusp2 T A 2: 127,336,892 Y172* probably null Het
Eml4 G A 17: 83,473,686 R771Q possibly damaging Het
Fat2 T A 11: 55,310,167 M694L probably benign Het
Fat2 C A 11: 55,311,160 E363* probably null Het
Gdpgp1 A G 7: 80,239,078 I286V probably damaging Het
Gm11639 A G 11: 104,999,698 N4202S possibly damaging Het
Gm11639 G A 11: 105,046,559 probably null Het
Gps1 T A 11: 120,786,373 V166E probably damaging Het
H60b T A 10: 22,286,156 N93K probably benign Het
Imp4 C T 1: 34,443,033 T79I probably benign Het
Kank3 A G 17: 33,818,867 S485G probably benign Het
Kcnv2 A G 19: 27,322,767 N6S probably benign Het
Krba1 A T 6: 48,411,669 Q534L probably damaging Het
Lgr4 A G 2: 110,006,518 N399S probably damaging Het
Lgr5 A G 10: 115,453,047 V564A probably damaging Het
Lrtm2 A G 6: 119,320,433 F216L probably benign Het
Lsm8 T A 6: 18,849,659 M22K probably benign Het
Mboat2 C T 12: 24,955,393 T389M probably damaging Het
Mcoln1 T G 8: 3,505,924 I73S probably damaging Het
Myh7 T A 14: 54,979,463 I1146F possibly damaging Het
Naa16 G A 14: 79,341,046 T666I possibly damaging Het
Ncoa1 A G 12: 4,335,873 S88P possibly damaging Het
Obscn T C 11: 59,050,508 T4496A possibly damaging Het
Olfr1351 T A 10: 79,018,038 F239I probably damaging Het
Olfr61 T C 7: 140,637,739 F13L probably damaging Het
Papd5 G A 8: 88,252,285 G505R probably null Het
Pdxk G T 10: 78,441,178 A262D possibly damaging Het
Pebp4 T A 14: 69,851,633 L68Q probably damaging Het
Pfdn5 C T 15: 102,328,543 H77Y possibly damaging Het
Pld1 T C 3: 28,076,502 Y484H probably damaging Het
Pou3f3 C A 1: 42,697,400 N85K unknown Het
Ppm1m C A 9: 106,197,945 A134S probably damaging Het
Prdm11 A T 2: 92,975,761 S281R possibly damaging Het
Prdm2 C A 4: 143,135,864 L285F probably damaging Het
Ptchd3 C T 11: 121,831,113 R271* probably null Het
Ptprq A C 10: 107,652,711 V955G probably damaging Het
Pygb A T 2: 150,815,669 M351L probably benign Het
Rcl1 G A 19: 29,118,405 probably null Het
Sgip1 A T 4: 102,928,900 T351S possibly damaging Het
Slc22a5 T C 11: 53,869,389 N367S probably damaging Het
Sox6 A G 7: 115,544,595 V437A probably benign Het
Spata16 T A 3: 26,667,423 M31K possibly damaging Het
Stab1 C A 14: 31,157,415 V703F possibly damaging Het
Tbc1d4 C T 14: 101,465,754 G752R probably damaging Het
Tes3-ps C T 13: 49,493,984 A112V probably benign Het
Tnfrsf19 T C 14: 60,970,933 T380A probably benign Het
Trim75 C T 8: 64,982,538 G420E probably damaging Het
Txlnb A G 10: 17,827,964 D290G probably benign Het
Unc5c T A 3: 141,828,477 F920I possibly damaging Het
Vmn1r233 T A 17: 20,993,975 R238* probably null Het
Vmn2r113 A G 17: 22,957,943 E567G probably benign Het
Vmn2r97 T A 17: 18,930,400 I503K probably damaging Het
Wdr62 A G 7: 30,265,159 W387R probably damaging Het
Zfp36l2 A T 17: 84,187,662 D11E probably benign Het
Other mutations in Clstn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Clstn3 APN 6 124462139 missense probably damaging 1.00
IGL01415:Clstn3 APN 6 124438822 nonsense probably null
IGL01521:Clstn3 APN 6 124458031 nonsense probably null
IGL01537:Clstn3 APN 6 124431600 missense possibly damaging 0.91
IGL01729:Clstn3 APN 6 124449794 missense probably benign 0.06
IGL01879:Clstn3 APN 6 124438810 missense probably damaging 1.00
IGL01998:Clstn3 APN 6 124458663 missense probably damaging 1.00
IGL03130:Clstn3 APN 6 124459263 missense probably damaging 0.98
IGL03405:Clstn3 APN 6 124438368 missense possibly damaging 0.95
PIT4403001:Clstn3 UTSW 6 124458023 missense probably damaging 1.00
R0049:Clstn3 UTSW 6 124459853 missense possibly damaging 0.87
R0049:Clstn3 UTSW 6 124459853 missense possibly damaging 0.87
R0208:Clstn3 UTSW 6 124432169 splice site probably benign
R0276:Clstn3 UTSW 6 124431740 splice site probably benign
R0440:Clstn3 UTSW 6 124451413 missense probably damaging 1.00
R0612:Clstn3 UTSW 6 124449500 missense probably damaging 0.98
R1200:Clstn3 UTSW 6 124459170 missense probably damaging 1.00
R1224:Clstn3 UTSW 6 124457919 missense probably benign
R1378:Clstn3 UTSW 6 124438419 missense probably damaging 1.00
R1491:Clstn3 UTSW 6 124437490 missense possibly damaging 0.51
R1495:Clstn3 UTSW 6 124449917 missense probably benign 0.00
R1511:Clstn3 UTSW 6 124462169 missense probably damaging 1.00
R1655:Clstn3 UTSW 6 124437427 missense probably damaging 1.00
R1731:Clstn3 UTSW 6 124431632 missense probably benign 0.04
R1734:Clstn3 UTSW 6 124436814 splice site probably benign
R1751:Clstn3 UTSW 6 124431999 missense probably damaging 1.00
R1954:Clstn3 UTSW 6 124459298 missense possibly damaging 0.94
R2133:Clstn3 UTSW 6 124449503 missense probably benign
R2192:Clstn3 UTSW 6 124459207 missense probably damaging 1.00
R2314:Clstn3 UTSW 6 124450717 missense probably benign 0.39
R2874:Clstn3 UTSW 6 124438335 missense probably damaging 1.00
R3500:Clstn3 UTSW 6 124431711 missense probably benign 0.01
R3761:Clstn3 UTSW 6 124457876 missense possibly damaging 0.54
R3878:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R3927:Clstn3 UTSW 6 124451368 missense probably damaging 1.00
R3934:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R3935:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R4063:Clstn3 UTSW 6 124449833 missense possibly damaging 0.51
R4402:Clstn3 UTSW 6 124456980 missense probably damaging 0.96
R4534:Clstn3 UTSW 6 124459220 missense probably damaging 1.00
R4785:Clstn3 UTSW 6 124437372 splice site probably null
R4834:Clstn3 UTSW 6 124431953 splice site probably null
R5921:Clstn3 UTSW 6 124431580 utr 3 prime probably benign
R5932:Clstn3 UTSW 6 124438332 missense probably benign 0.01
R6025:Clstn3 UTSW 6 124431664 missense possibly damaging 0.73
R6101:Clstn3 UTSW 6 124461670 missense probably damaging 1.00
R6360:Clstn3 UTSW 6 124438429 missense possibly damaging 0.88
R6578:Clstn3 UTSW 6 124450704 critical splice donor site probably null
R6813:Clstn3 UTSW 6 124436935 missense probably benign 0.00
R7380:Clstn3 UTSW 6 124456989 missense probably benign 0.01
R7419:Clstn3 UTSW 6 124458129 missense probably benign 0.05
R7625:Clstn3 UTSW 6 124437418 nonsense probably null
R7780:Clstn3 UTSW 6 124462202 missense probably damaging 0.98
R7939:Clstn3 UTSW 6 124462199 missense probably damaging 1.00
R8047:Clstn3 UTSW 6 124432013 missense possibly damaging 0.73
R8079:Clstn3 UTSW 6 124459804 missense probably damaging 1.00
R8085:Clstn3 UTSW 6 124458724 missense probably benign 0.23
R8299:Clstn3 UTSW 6 124437373 critical splice donor site probably null
R8406:Clstn3 UTSW 6 124462177 missense probably damaging 1.00
RF014:Clstn3 UTSW 6 124459266 nonsense probably null
X0066:Clstn3 UTSW 6 124449811 missense probably benign 0.13
Z1176:Clstn3 UTSW 6 124459200 missense probably damaging 1.00
Z1177:Clstn3 UTSW 6 124449781 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACAAGCATGCGCCATTG -3'
(R):5'- AAATTGCCCAGGTATGCTGGG -3'

Sequencing Primer
(F):5'- TGCGCCATTGCAGAGTC -3'
(R):5'- ATGCTGGGTTCTGCTGACCC -3'
Posted On2020-09-15