Mutagenetix > Incidental Mutations

Incidental Mutation 'R7936:Mcoln1'

648737

Institutional Source

Beutler Lab

Gene Symbol

Mcoln1

Ensembl Gene

ENSMUSG00000004567

Gene Name

mucolipin 1

Synonyms

TRPML1, mucolipidin, 2210015I05Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.167) question?

Stock #

R7936 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3500457-3515232 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 3505924 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 73 (I73S)

Ref Sequence

ENSEMBL: ENSMUSP00000004683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004683] [ENSMUST00000160338] [ENSMUST00000208306]

AlphaFold

Q99J21

Predicted Effect

probably damaging
Transcript: ENSMUST00000004683
AA Change: I73S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000004683
Gene: ENSMUSG00000004567
AA Change: I73S

Domain	Start	End	E-Value	Type
low complexity region	30	39	N/A	INTRINSIC
transmembrane domain	70	92	N/A	INTRINSIC
transmembrane domain	299	321	N/A	INTRINSIC
transmembrane domain	348	370	N/A	INTRINSIC
Pfam:PKD_channel	378	524	2.1e-12	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000160338
AA Change: I73S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000123717
Gene: ENSMUSG00000004567
AA Change: I73S

Domain	Start	End	E-Value	Type
low complexity region	30	39	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000208306
AA Change: I73S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

Meta Mutation Damage Score

0.7475

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a memberof the transient receptor potential (TRP) cation channel gene family. The transmembrane protein localizes to intracellular vesicular membranes including lysosomes, and functions in the late endocytic pathway and in the regulation of lysosomal exocytosis. The channel is permeable to Ca(2+), Fe(2+), Na(+), K(+), and H(+), and is modulated by changes in Ca(2+) concentration. Mutations in this gene result in mucolipidosis type IV. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit premature death around 8 months of age preceeded by weight loss, weakness, lethargy, bladder and stomach distension, and retinal degradation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	T	A	6: 91,923,464	L438*	probably null	Het
Adamts18	T	A	8: 113,767,128	I460F	probably damaging	Het
Api5	C	T	2: 94,438,047		probably benign	Het
Arap2	A	G	5: 62,730,705	S433P	probably damaging	Het
Arhgap26	T	C	18: 39,205,287	Y371H	probably damaging	Het
Asf1b	T	C	8: 83,969,219	I163T	probably benign	Het
Cacna2d2	A	G	9: 107,524,127	N696S	probably damaging	Het
Carns1	A	C	19: 4,166,153	S677A	probably benign	Het
Cd276	G	A	9: 58,540,830		probably benign	Het
Cdk8	T	A	5: 146,299,834	M353K	possibly damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Chsy3	A	G	18: 59,409,346	I519V	probably damaging	Het
Chtop	T	C	3: 90,507,351		probably benign	Het
Clstn3	T	A	6: 124,432,013	D892V	possibly damaging	Het
Col16a1	A	T	4: 130,096,871		probably null	Het
Dnah5	A	G	15: 28,345,837	E2441G	possibly damaging	Het
Dpy19l2	T	G	9: 24,558,158	D734A	probably damaging	Het
Dusp2	T	A	2: 127,336,892	Y172*	probably null	Het
Eml4	G	A	17: 83,473,686	R771Q	possibly damaging	Het
Fat2	T	A	11: 55,310,167	M694L	probably benign	Het
Fat2	C	A	11: 55,311,160	E363*	probably null	Het
Gdpgp1	A	G	7: 80,239,078	I286V	probably damaging	Het
Gm11639	A	G	11: 104,999,698	N4202S	possibly damaging	Het
Gm11639	G	A	11: 105,046,559		probably null	Het
Gps1	T	A	11: 120,786,373	V166E	probably damaging	Het
H60b	T	A	10: 22,286,156	N93K	probably benign	Het
Imp4	C	T	1: 34,443,033	T79I	probably benign	Het
Kank3	A	G	17: 33,818,867	S485G	probably benign	Het
Kcnv2	A	G	19: 27,322,767	N6S	probably benign	Het
Krba1	A	T	6: 48,411,669	Q534L	probably damaging	Het
Lgr4	A	G	2: 110,006,518	N399S	probably damaging	Het
Lgr5	A	G	10: 115,453,047	V564A	probably damaging	Het
Lrtm2	A	G	6: 119,320,433	F216L	probably benign	Het
Lsm8	T	A	6: 18,849,659	M22K	probably benign	Het
Mboat2	C	T	12: 24,955,393	T389M	probably damaging	Het
Myh7	T	A	14: 54,979,463	I1146F	possibly damaging	Het
Naa16	G	A	14: 79,341,046	T666I	possibly damaging	Het
Ncoa1	A	G	12: 4,335,873	S88P	possibly damaging	Het
Obscn	T	C	11: 59,050,508	T4496A	possibly damaging	Het
Olfr1351	T	A	10: 79,018,038	F239I	probably damaging	Het
Olfr61	T	C	7: 140,637,739	F13L	probably damaging	Het
Papd5	G	A	8: 88,252,285	G505R	probably null	Het
Pdxk	G	T	10: 78,441,178	A262D	possibly damaging	Het
Pebp4	T	A	14: 69,851,633	L68Q	probably damaging	Het
Pfdn5	C	T	15: 102,328,543	H77Y	possibly damaging	Het
Pld1	T	C	3: 28,076,502	Y484H	probably damaging	Het
Pou3f3	C	A	1: 42,697,400	N85K	unknown	Het
Ppm1m	C	A	9: 106,197,945	A134S	probably damaging	Het
Prdm11	A	T	2: 92,975,761	S281R	possibly damaging	Het
Prdm2	C	A	4: 143,135,864	L285F	probably damaging	Het
Ptchd3	C	T	11: 121,831,113	R271*	probably null	Het
Ptprq	A	C	10: 107,652,711	V955G	probably damaging	Het
Pygb	A	T	2: 150,815,669	M351L	probably benign	Het
Rcl1	G	A	19: 29,118,405		probably null	Het
Sgip1	A	T	4: 102,928,900	T351S	possibly damaging	Het
Slc22a5	T	C	11: 53,869,389	N367S	probably damaging	Het
Sox6	A	G	7: 115,544,595	V437A	probably benign	Het
Spata16	T	A	3: 26,667,423	M31K	possibly damaging	Het
Stab1	C	A	14: 31,157,415	V703F	possibly damaging	Het
Tbc1d4	C	T	14: 101,465,754	G752R	probably damaging	Het
Tes3-ps	C	T	13: 49,493,984	A112V	probably benign	Het
Tnfrsf19	T	C	14: 60,970,933	T380A	probably benign	Het
Trim75	C	T	8: 64,982,538	G420E	probably damaging	Het
Txlnb	A	G	10: 17,827,964	D290G	probably benign	Het
Unc5c	T	A	3: 141,828,477	F920I	possibly damaging	Het
Vmn1r233	T	A	17: 20,993,975	R238*	probably null	Het
Vmn2r113	A	G	17: 22,957,943	E567G	probably benign	Het
Vmn2r97	T	A	17: 18,930,400	I503K	probably damaging	Het
Wdr62	A	G	7: 30,265,159	W387R	probably damaging	Het
Zfp36l2	A	T	17: 84,187,662	D11E	probably benign	Het

Other mutations in Mcoln1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01362:Mcoln1	APN	8	3507558	missense	possibly damaging	0.89
IGL01621:Mcoln1	APN	8	3510910	missense	probably damaging	1.00
IGL02147:Mcoln1	APN	8	3508379	missense	probably benign
IGL02156:Mcoln1	APN	8	3512657	nonsense	probably null
R0616:Mcoln1	UTSW	8	3515025	missense	probably benign	0.00
R1498:Mcoln1	UTSW	8	3512861	missense	probably damaging	1.00
R2102:Mcoln1	UTSW	8	3511731	missense	probably damaging	1.00
R2155:Mcoln1	UTSW	8	3511787	missense	probably damaging	1.00
R2178:Mcoln1	UTSW	8	3508766	missense	probably damaging	1.00
R2218:Mcoln1	UTSW	8	3505813	missense	possibly damaging	0.50
R3828:Mcoln1	UTSW	8	3500601	missense	possibly damaging	0.93
R3875:Mcoln1	UTSW	8	3508355	missense	probably benign
R3971:Mcoln1	UTSW	8	3507408	missense	probably benign	0.01
R4621:Mcoln1	UTSW	8	3505923	missense	probably damaging	1.00
R4622:Mcoln1	UTSW	8	3505923	missense	probably damaging	1.00
R4659:Mcoln1	UTSW	8	3510840	missense	probably damaging	1.00
R4873:Mcoln1	UTSW	8	3507422	missense	probably benign	0.00
R4875:Mcoln1	UTSW	8	3507422	missense	probably benign	0.00
R4914:Mcoln1	UTSW	8	3507483	nonsense	probably null
R5114:Mcoln1	UTSW	8	3510697	unclassified	probably benign
R5586:Mcoln1	UTSW	8	3510389	missense	probably damaging	1.00
R5876:Mcoln1	UTSW	8	3510910	missense	probably damaging	1.00
R5946:Mcoln1	UTSW	8	3508701	missense	probably damaging	1.00
R6520:Mcoln1	UTSW	8	3505855	missense	probably damaging	1.00
R7449:Mcoln1	UTSW	8	3507285	missense	probably damaging	0.98
R7712:Mcoln1	UTSW	8	3505873	missense	probably damaging	0.99
R7904:Mcoln1	UTSW	8	3508356	missense	probably benign
R8058:Mcoln1	UTSW	8	3508378	missense	probably benign
R8082:Mcoln1	UTSW	8	3507420	missense	probably benign	0.01
R8093:Mcoln1	UTSW	8	3508740	missense	possibly damaging	0.95
R9090:Mcoln1	UTSW	8	3505771	missense	probably damaging	1.00
R9271:Mcoln1	UTSW	8	3505771	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTTAGAGACTGAGCGGCTGC -3'
(R):5'- CATTTTGGGTATACAACGGAGGTG -3'

Sequencing Primer
(F):5'- TGCTGACCCCCAATCCTGG -3'
(R):5'- AGAGAGTGGCCAGTGCTGC -3'

Posted On

2020-09-15