Incidental Mutation 'R7936:Mcoln1'
ID 648737
Institutional Source Beutler Lab
Gene Symbol Mcoln1
Ensembl Gene ENSMUSG00000004567
Gene Name mucolipin 1
Synonyms TRPML1, mucolipidin, 2210015I05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock # R7936 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 3500457-3515232 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 3505924 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 73 (I73S)
Ref Sequence ENSEMBL: ENSMUSP00000004683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004683] [ENSMUST00000160338] [ENSMUST00000208306]
AlphaFold Q99J21
Predicted Effect probably damaging
Transcript: ENSMUST00000004683
AA Change: I73S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004683
Gene: ENSMUSG00000004567
AA Change: I73S

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:PKD_channel 378 524 2.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160338
AA Change: I73S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123717
Gene: ENSMUSG00000004567
AA Change: I73S

DomainStartEndE-ValueType
low complexity region 30 39 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000208306
AA Change: I73S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.7475 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a memberof the transient receptor potential (TRP) cation channel gene family. The transmembrane protein localizes to intracellular vesicular membranes including lysosomes, and functions in the late endocytic pathway and in the regulation of lysosomal exocytosis. The channel is permeable to Ca(2+), Fe(2+), Na(+), K(+), and H(+), and is modulated by changes in Ca(2+) concentration. Mutations in this gene result in mucolipidosis type IV. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit premature death around 8 months of age preceeded by weight loss, weakness, lethargy, bladder and stomach distension, and retinal degradation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T A 6: 91,923,464 L438* probably null Het
Adamts18 T A 8: 113,767,128 I460F probably damaging Het
Api5 C T 2: 94,438,047 probably benign Het
Arap2 A G 5: 62,730,705 S433P probably damaging Het
Arhgap26 T C 18: 39,205,287 Y371H probably damaging Het
Asf1b T C 8: 83,969,219 I163T probably benign Het
Cacna2d2 A G 9: 107,524,127 N696S probably damaging Het
Carns1 A C 19: 4,166,153 S677A probably benign Het
Cd276 G A 9: 58,540,830 probably benign Het
Cdk8 T A 5: 146,299,834 M353K possibly damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Chsy3 A G 18: 59,409,346 I519V probably damaging Het
Chtop T C 3: 90,507,351 probably benign Het
Clstn3 T A 6: 124,432,013 D892V possibly damaging Het
Col16a1 A T 4: 130,096,871 probably null Het
Dnah5 A G 15: 28,345,837 E2441G possibly damaging Het
Dpy19l2 T G 9: 24,558,158 D734A probably damaging Het
Dusp2 T A 2: 127,336,892 Y172* probably null Het
Eml4 G A 17: 83,473,686 R771Q possibly damaging Het
Fat2 T A 11: 55,310,167 M694L probably benign Het
Fat2 C A 11: 55,311,160 E363* probably null Het
Gdpgp1 A G 7: 80,239,078 I286V probably damaging Het
Gm11639 A G 11: 104,999,698 N4202S possibly damaging Het
Gm11639 G A 11: 105,046,559 probably null Het
Gps1 T A 11: 120,786,373 V166E probably damaging Het
H60b T A 10: 22,286,156 N93K probably benign Het
Imp4 C T 1: 34,443,033 T79I probably benign Het
Kank3 A G 17: 33,818,867 S485G probably benign Het
Kcnv2 A G 19: 27,322,767 N6S probably benign Het
Krba1 A T 6: 48,411,669 Q534L probably damaging Het
Lgr4 A G 2: 110,006,518 N399S probably damaging Het
Lgr5 A G 10: 115,453,047 V564A probably damaging Het
Lrtm2 A G 6: 119,320,433 F216L probably benign Het
Lsm8 T A 6: 18,849,659 M22K probably benign Het
Mboat2 C T 12: 24,955,393 T389M probably damaging Het
Myh7 T A 14: 54,979,463 I1146F possibly damaging Het
Naa16 G A 14: 79,341,046 T666I possibly damaging Het
Ncoa1 A G 12: 4,335,873 S88P possibly damaging Het
Obscn T C 11: 59,050,508 T4496A possibly damaging Het
Olfr1351 T A 10: 79,018,038 F239I probably damaging Het
Olfr61 T C 7: 140,637,739 F13L probably damaging Het
Papd5 G A 8: 88,252,285 G505R probably null Het
Pdxk G T 10: 78,441,178 A262D possibly damaging Het
Pebp4 T A 14: 69,851,633 L68Q probably damaging Het
Pfdn5 C T 15: 102,328,543 H77Y possibly damaging Het
Pld1 T C 3: 28,076,502 Y484H probably damaging Het
Pou3f3 C A 1: 42,697,400 N85K unknown Het
Ppm1m C A 9: 106,197,945 A134S probably damaging Het
Prdm11 A T 2: 92,975,761 S281R possibly damaging Het
Prdm2 C A 4: 143,135,864 L285F probably damaging Het
Ptchd3 C T 11: 121,831,113 R271* probably null Het
Ptprq A C 10: 107,652,711 V955G probably damaging Het
Pygb A T 2: 150,815,669 M351L probably benign Het
Rcl1 G A 19: 29,118,405 probably null Het
Sgip1 A T 4: 102,928,900 T351S possibly damaging Het
Slc22a5 T C 11: 53,869,389 N367S probably damaging Het
Sox6 A G 7: 115,544,595 V437A probably benign Het
Spata16 T A 3: 26,667,423 M31K possibly damaging Het
Stab1 C A 14: 31,157,415 V703F possibly damaging Het
Tbc1d4 C T 14: 101,465,754 G752R probably damaging Het
Tes3-ps C T 13: 49,493,984 A112V probably benign Het
Tnfrsf19 T C 14: 60,970,933 T380A probably benign Het
Trim75 C T 8: 64,982,538 G420E probably damaging Het
Txlnb A G 10: 17,827,964 D290G probably benign Het
Unc5c T A 3: 141,828,477 F920I possibly damaging Het
Vmn1r233 T A 17: 20,993,975 R238* probably null Het
Vmn2r113 A G 17: 22,957,943 E567G probably benign Het
Vmn2r97 T A 17: 18,930,400 I503K probably damaging Het
Wdr62 A G 7: 30,265,159 W387R probably damaging Het
Zfp36l2 A T 17: 84,187,662 D11E probably benign Het
Other mutations in Mcoln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Mcoln1 APN 8 3507558 missense possibly damaging 0.89
IGL01621:Mcoln1 APN 8 3510910 missense probably damaging 1.00
IGL02147:Mcoln1 APN 8 3508379 missense probably benign
IGL02156:Mcoln1 APN 8 3512657 nonsense probably null
R0616:Mcoln1 UTSW 8 3515025 missense probably benign 0.00
R1498:Mcoln1 UTSW 8 3512861 missense probably damaging 1.00
R2102:Mcoln1 UTSW 8 3511731 missense probably damaging 1.00
R2155:Mcoln1 UTSW 8 3511787 missense probably damaging 1.00
R2178:Mcoln1 UTSW 8 3508766 missense probably damaging 1.00
R2218:Mcoln1 UTSW 8 3505813 missense possibly damaging 0.50
R3828:Mcoln1 UTSW 8 3500601 missense possibly damaging 0.93
R3875:Mcoln1 UTSW 8 3508355 missense probably benign
R3971:Mcoln1 UTSW 8 3507408 missense probably benign 0.01
R4621:Mcoln1 UTSW 8 3505923 missense probably damaging 1.00
R4622:Mcoln1 UTSW 8 3505923 missense probably damaging 1.00
R4659:Mcoln1 UTSW 8 3510840 missense probably damaging 1.00
R4873:Mcoln1 UTSW 8 3507422 missense probably benign 0.00
R4875:Mcoln1 UTSW 8 3507422 missense probably benign 0.00
R4914:Mcoln1 UTSW 8 3507483 nonsense probably null
R5114:Mcoln1 UTSW 8 3510697 unclassified probably benign
R5586:Mcoln1 UTSW 8 3510389 missense probably damaging 1.00
R5876:Mcoln1 UTSW 8 3510910 missense probably damaging 1.00
R5946:Mcoln1 UTSW 8 3508701 missense probably damaging 1.00
R6520:Mcoln1 UTSW 8 3505855 missense probably damaging 1.00
R7449:Mcoln1 UTSW 8 3507285 missense probably damaging 0.98
R7712:Mcoln1 UTSW 8 3505873 missense probably damaging 0.99
R7904:Mcoln1 UTSW 8 3508356 missense probably benign
R8058:Mcoln1 UTSW 8 3508378 missense probably benign
R8082:Mcoln1 UTSW 8 3507420 missense probably benign 0.01
R8093:Mcoln1 UTSW 8 3508740 missense possibly damaging 0.95
R9090:Mcoln1 UTSW 8 3505771 missense probably damaging 1.00
R9271:Mcoln1 UTSW 8 3505771 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTAGAGACTGAGCGGCTGC -3'
(R):5'- CATTTTGGGTATACAACGGAGGTG -3'

Sequencing Primer
(F):5'- TGCTGACCCCCAATCCTGG -3'
(R):5'- AGAGAGTGGCCAGTGCTGC -3'
Posted On 2020-09-15