Incidental Mutation 'R0014:F2rl2'
ID64876
Institutional Source Beutler Lab
Gene Symbol F2rl2
Ensembl Gene ENSMUSG00000021675
Gene Namecoagulation factor II (thrombin) receptor-like 2
SynonymsPAR3
MMRRC Submission 038309-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0014 (G1)
Quality Score146
Status Validated
Chromosome13
Chromosomal Location95696853-95702739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95700909 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 154 (N154I)
Ref Sequence ENSEMBL: ENSMUSP00000022182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022182] [ENSMUST00000068603]
PDB Structure
Crystal structure of murine thrombin in complex with the extracellular fragment of murine PAR3 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000022182
AA Change: N154I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022182
Gene: ENSMUSG00000021675
AA Change: N154I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:7tm_1 110 295 1.7e-32 PFAM
Pfam:7tm_1 297 357 1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068603
SMART Domains Protein: ENSMUSP00000067685
Gene: ENSMUSG00000021676

DomainStartEndE-ValueType
CH 43 152 3.32e-16 SMART
coiled coil region 253 276 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
IQ 689 711 1.38e-4 SMART
IQ 719 741 7.36e0 SMART
IQ 749 771 2.43e1 SMART
coiled coil region 799 828 N/A INTRINSIC
RasGAP 905 1258 2.6e-120 SMART
Pfam:RasGAP_C 1367 1498 3.2e-40 PFAM
Meta Mutation Damage Score 0.1939 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protease-activated receptor (PAR) family which is a subfamily of the seven transmembrane G protein-coupled cell surface receptor family. The encoded protein acts as a cofactor in the thrombin-mediated cleavage and activation of the protease-activated receptor family member PAR4. The encoded protein plays an essential role in hemostasis and thrombosis. Alternate splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in prolonged bleeding times, delayed and reduced thrombin responses in platelets, and protection against thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik T C 1: 181,055,131 F153L possibly damaging Het
A1bg T A 15: 60,919,732 D92V probably damaging Het
Ankrd52 C A 10: 128,386,452 T583K probably benign Het
C3ar1 C T 6: 122,850,851 V136M probably damaging Het
Capg A G 6: 72,561,043 E304G possibly damaging Het
Ccdc125 A C 13: 100,684,338 N189T possibly damaging Het
Ccr5 T C 9: 124,124,621 F87S probably damaging Het
Cd2ap T C 17: 42,807,928 S540G probably benign Het
Cdt1 C T 8: 122,572,566 T529M probably benign Het
Cfap126 A G 1: 171,125,784 D49G possibly damaging Het
Cngb3 T C 4: 19,396,685 I346T probably benign Het
Dgkd A G 1: 87,881,881 D97G probably damaging Het
Dgkg A T 16: 22,565,364 probably null Het
Dmbx1 G T 4: 115,918,024 T358K probably damaging Het
Epc2 A T 2: 49,522,525 K172* probably null Het
Fyttd1 G A 16: 32,905,554 R175Q probably damaging Het
Gbp5 T A 3: 142,506,735 C395S probably damaging Het
Gen1 T C 12: 11,241,641 N716D probably benign Het
Helz2 A G 2: 181,240,511 L163P probably damaging Het
Hmox2 T A 16: 4,765,033 L210Q probably damaging Het
Klhl28 T C 12: 64,957,302 T146A probably benign Het
Lrrk2 T C 15: 91,802,045 probably benign Het
Man2c1 T A 9: 57,139,701 M580K probably benign Het
Neb G A 2: 52,287,156 A1391V probably damaging Het
Nyap2 T C 1: 81,241,951 S563P probably damaging Het
Olfr1301 A G 2: 111,754,774 D175G probably damaging Het
Olfr520 T C 7: 99,736,049 V302A probably damaging Het
Olfr543 A G 7: 102,477,477 I131T probably damaging Het
P2rx5 T A 11: 73,167,062 probably benign Het
Pclo C T 5: 14,680,451 probably benign Het
Pex1 G A 5: 3,626,141 probably benign Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Psma8 A G 18: 14,726,530 I86V possibly damaging Het
Ptpdc1 G T 13: 48,586,919 Y345* probably null Het
Rcbtb1 G T 14: 59,235,242 K493N probably benign Het
Rexo2 A T 9: 48,474,447 S126T probably benign Het
Rorc T A 3: 94,377,613 probably benign Het
Slc7a2 T C 8: 40,911,028 L426P probably damaging Het
Syde1 T C 10: 78,590,034 T100A probably benign Het
Tbc1d20 A T 2: 152,311,781 Q342L probably benign Het
Thbs1 A G 2: 118,113,350 T150A possibly damaging Het
Trpm1 A G 7: 64,248,222 H317R probably damaging Het
Tut1 T A 19: 8,962,447 L265Q possibly damaging Het
Wdfy4 A G 14: 33,107,173 F1029L possibly damaging Het
Wdr63 T C 3: 146,081,423 probably null Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp458 A G 13: 67,258,090 V95A possibly damaging Het
Zscan18 A T 7: 12,769,417 F738L possibly damaging Het
Other mutations in F2rl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:F2rl2 APN 13 95701328 missense probably benign 0.00
R0014:F2rl2 UTSW 13 95700909 missense probably damaging 0.99
R0969:F2rl2 UTSW 13 95700953 missense probably damaging 1.00
R1183:F2rl2 UTSW 13 95701113 missense probably damaging 0.96
R1482:F2rl2 UTSW 13 95701539 missense probably benign 0.02
R1753:F2rl2 UTSW 13 95701461 missense probably benign 0.16
R2428:F2rl2 UTSW 13 95697077 missense possibly damaging 0.75
R3151:F2rl2 UTSW 13 95701130 missense probably benign 0.00
R4678:F2rl2 UTSW 13 95700632 missense probably benign 0.10
R5153:F2rl2 UTSW 13 95697112 missense probably benign 0.00
R5229:F2rl2 UTSW 13 95700687 missense possibly damaging 0.93
R5635:F2rl2 UTSW 13 95700782 missense possibly damaging 0.88
R6041:F2rl2 UTSW 13 95701109 missense probably benign 0.01
R6146:F2rl2 UTSW 13 95700641 missense probably benign 0.08
R6974:F2rl2 UTSW 13 95700530 missense probably damaging 0.97
R6993:F2rl2 UTSW 13 95701134 missense probably damaging 1.00
R7833:F2rl2 UTSW 13 95700918 missense probably damaging 0.96
R7869:F2rl2 UTSW 13 95701011 missense probably damaging 0.99
R7916:F2rl2 UTSW 13 95700918 missense probably damaging 0.96
R7952:F2rl2 UTSW 13 95701011 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTATAAAAGCGGAGTGTCCCGAGG -3'
(R):5'- TGCCACACATGAGCATGGAGAAGC -3'

Sequencing Primer
(F):5'- TGTCCCGAGGACAGTATTTCAAC -3'
(R):5'- CATGGAGAAGCTGCGTTTG -3'
Posted On2013-08-06