Incidental Mutation 'R7937:Pid1'
ID 648783
Institutional Source Beutler Lab
Gene Symbol Pid1
Ensembl Gene ENSMUSG00000045658
Gene Name phosphotyrosine interaction domain containing 1
Synonyms 5033414K04Rik
MMRRC Submission 045983-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.338) question?
Stock # R7937 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 84014014-84317550 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 84093745 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 48 (Q48K)
Ref Sequence ENSEMBL: ENSMUSP00000135425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168574] [ENSMUST00000175996] [ENSMUST00000176559] [ENSMUST00000176720] [ENSMUST00000176822]
AlphaFold Q3UBG2
Predicted Effect probably benign
Transcript: ENSMUST00000168574
SMART Domains Protein: ENSMUSP00000127716
Gene: ENSMUSG00000045658

DomainStartEndE-ValueType
Pfam:PID_2 57 213 2.5e-21 PFAM
Pfam:PID 59 196 1.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175996
Predicted Effect probably benign
Transcript: ENSMUST00000176559
SMART Domains Protein: ENSMUSP00000135164
Gene: ENSMUSG00000045658

DomainStartEndE-ValueType
Pfam:PID_2 43 198 3.7e-21 PFAM
Pfam:PID 45 182 6.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176720
Predicted Effect probably benign
Transcript: ENSMUST00000176822
AA Change: Q48K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 GTTGATCCATACA G 2: 69,154,217 (GRCm39) probably benign Het
Ano6 C A 15: 95,870,470 (GRCm39) T875K probably damaging Het
Armc8 G A 9: 99,418,272 (GRCm39) T94I probably damaging Het
Ash1l C T 3: 88,977,624 (GRCm39) R2685* probably null Het
Bri3bp A T 5: 125,531,395 (GRCm39) N114Y probably damaging Het
Camkk2 G T 5: 122,902,097 (GRCm39) Q71K probably benign Het
Cc2d2b T C 19: 40,765,736 (GRCm39) F49S Het
Cdh10 A G 15: 18,964,335 (GRCm39) T166A probably benign Het
Chd8 A G 14: 52,464,963 (GRCm39) F633L probably benign Het
Clec2m A G 6: 129,307,974 (GRCm39) W32R possibly damaging Het
Cntn5 G A 9: 9,748,450 (GRCm39) T477I probably damaging Het
Cyp2c37 T A 19: 39,982,202 (GRCm39) Y68N probably damaging Het
Dnah2 A T 11: 69,408,511 (GRCm39) L53* probably null Het
Dnajc11 A G 4: 152,034,909 (GRCm39) D44G probably damaging Het
Elovl3 T C 19: 46,123,168 (GRCm39) F248S probably damaging Het
Etfdh A G 3: 79,517,123 (GRCm39) L422P probably benign Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fgd4 A G 16: 16,287,637 (GRCm39) Y355H probably damaging Het
Fgfr2 A G 7: 129,820,823 (GRCm39) M237T probably damaging Het
Gdap1 A T 1: 17,230,177 (GRCm39) K203N probably benign Het
Glis1 A G 4: 107,484,723 (GRCm39) D594G possibly damaging Het
Gm4787 T A 12: 81,424,679 (GRCm39) H493L probably benign Het
Gpatch3 G T 4: 133,310,308 (GRCm39) V418L probably damaging Het
Greb1 T C 12: 16,766,670 (GRCm39) N376S probably damaging Het
Hspg2 A G 4: 137,278,243 (GRCm39) Q3010R probably benign Het
Ice2 T A 9: 69,318,067 (GRCm39) F223I possibly damaging Het
Marchf11 A G 15: 26,409,323 (GRCm39) T341A probably damaging Het
Mllt10 A G 2: 18,210,895 (GRCm39) K770E probably damaging Het
Mug1 A G 6: 121,838,128 (GRCm39) T453A probably benign Het
Myh15 C T 16: 48,976,009 (GRCm39) T1359I probably benign Het
Nbn A G 4: 15,958,080 (GRCm39) K3E probably damaging Het
Nlrp4a T C 7: 26,163,571 (GRCm39) F913L probably benign Het
Nlrx1 G T 9: 44,176,086 (GRCm39) A48D probably damaging Het
Noc3l C G 19: 38,783,447 (GRCm39) G643A possibly damaging Het
Or4f14b T C 2: 111,774,875 (GRCm39) R309G probably benign Het
Or8c17 T A 9: 38,180,344 (GRCm39) N170K probably benign Het
Pde6b G T 5: 108,567,639 (GRCm39) probably null Het
Phactr1 A G 13: 43,231,205 (GRCm39) I247V unknown Het
Ppfia2 A G 10: 106,699,233 (GRCm39) N794S probably benign Het
Ppox G A 1: 171,107,546 (GRCm39) S123L possibly damaging Het
Ptprd A C 4: 76,013,772 (GRCm39) D778E probably benign Het
Rgs13 A G 1: 144,016,600 (GRCm39) Y48H probably damaging Het
Rgs17 T A 10: 5,783,078 (GRCm39) M190L probably benign Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Scaf8 C T 17: 3,247,482 (GRCm39) P935L probably damaging Het
Slc22a6 T C 19: 8,601,253 (GRCm39) I435T probably benign Het
Slc34a1 A G 13: 23,996,648 (GRCm39) H51R probably benign Het
Snx4 T C 16: 33,112,199 (GRCm39) L378P probably damaging Het
Spns1 A G 7: 125,973,226 (GRCm39) L155P probably damaging Het
St8sia4 T C 1: 95,581,320 (GRCm39) T141A possibly damaging Het
Syt10 A T 15: 89,666,820 (GRCm39) S510R probably damaging Het
Tmprss11d A T 5: 86,457,349 (GRCm39) F241L probably benign Het
Tnfrsf21 A T 17: 43,348,816 (GRCm39) T143S probably benign Het
Trim72 A G 7: 127,609,491 (GRCm39) N431S probably benign Het
Usp43 A G 11: 67,746,615 (GRCm39) S1031P probably damaging Het
Wdr75 A G 1: 45,858,799 (GRCm39) Y656C probably benign Het
Zfp28 T C 7: 6,396,785 (GRCm39) C407R probably damaging Het
Zfp804b C T 5: 6,821,866 (GRCm39) R399Q possibly damaging Het
Zfp949 T A 9: 88,451,323 (GRCm39) C298S probably damaging Het
Other mutations in Pid1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Pid1 APN 1 84,016,227 (GRCm39) missense probably damaging 0.98
IGL01357:Pid1 APN 1 84,016,026 (GRCm39) missense probably damaging 1.00
R0976:Pid1 UTSW 1 84,136,946 (GRCm39) missense probably benign 0.01
R1365:Pid1 UTSW 1 84,015,862 (GRCm39) missense probably damaging 0.97
R2202:Pid1 UTSW 1 84,016,159 (GRCm39) missense probably damaging 0.97
R3772:Pid1 UTSW 1 84,015,918 (GRCm39) missense probably damaging 1.00
R4947:Pid1 UTSW 1 84,015,981 (GRCm39) missense possibly damaging 0.65
R7347:Pid1 UTSW 1 84,136,850 (GRCm39) missense unknown
R8083:Pid1 UTSW 1 84,015,970 (GRCm39) missense probably benign 0.01
R8170:Pid1 UTSW 1 84,262,721 (GRCm39) splice site probably null
R8755:Pid1 UTSW 1 84,016,066 (GRCm39) missense probably damaging 1.00
R8847:Pid1 UTSW 1 84,093,694 (GRCm39) missense unknown
R9114:Pid1 UTSW 1 84,015,955 (GRCm39) missense probably damaging 1.00
R9364:Pid1 UTSW 1 84,137,032 (GRCm39) missense probably benign 0.01
R9554:Pid1 UTSW 1 84,137,032 (GRCm39) missense probably benign 0.01
Z1088:Pid1 UTSW 1 84,093,735 (GRCm39) missense probably benign 0.00
Z1177:Pid1 UTSW 1 84,016,192 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCACAGAAAGAGCTGTATCAC -3'
(R):5'- TCGAAATGCTAAGTGCTACATGTG -3'

Sequencing Primer
(F):5'- GAGCTGTATCACCCACCAGAGG -3'
(R):5'- AATGCTAAGTGCTACATGTGAGTCTG -3'
Posted On 2020-09-15