Incidental Mutation 'R0014:Cd2ap'
ID64879
Institutional Source Beutler Lab
Gene Symbol Cd2ap
Ensembl Gene ENSMUSG00000061665
Gene NameCD2-associated protein
SynonymsMets1, METS-1
MMRRC Submission 038309-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0014 (G1)
Quality Score117
Status Validated
Chromosome17
Chromosomal Location42792951-42876424 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42807928 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 540 (S540G)
Ref Sequence ENSEMBL: ENSMUSP00000024709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024709]
PDB Structure
Third SH3 domain of CD2AP [SOLUTION NMR]
RDC refined solution structure of the first SH3 domain of CD2AP [SOLUTION NMR]
High resolution structure of the second SH3 domain of CD2AP [SOLUTION NMR]
RDC refined high resolution structure of the third SH3 domain of CD2AP [SOLUTION NMR]
Distinct ubiquitin binding modes exhibited by sh3 domains: molecular determinants and functional implications [SOLUTION NMR]
Distinct ubiquitin binding modes exhibited by SH3 domains: molecular determinants and functional implications [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000024709
AA Change: S540G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024709
Gene: ENSMUSG00000061665
AA Change: S540G

DomainStartEndE-ValueType
SH3 2 58 4.48e-19 SMART
SH3 111 166 6.63e-22 SMART
low complexity region 183 195 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SH3 272 329 4.62e-21 SMART
low complexity region 336 352 N/A INTRINSIC
low complexity region 377 399 N/A INTRINSIC
low complexity region 410 422 N/A INTRINSIC
PDB:3LK4|9 475 503 2e-12 PDB
low complexity region 536 555 N/A INTRINSIC
coiled coil region 595 635 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: This gene encodes a scaffolding molecule that regulates the actin cytoskeleton. The protein directly interacts with filamentous actin and a variety of cell membrane proteins through multiple actin binding sites, SH3 domains, and a proline-rich region containing binding sites for SH3 domains. The cytoplasmic protein localizes to membrane ruffles, lipid rafts, and the leading edges of cells. It is implicated in dynamic actin remodeling and membrane trafficking that occurs during receptor endocytosis and cytokinesis. The mouse genome contains at least two pseudogenes located on chromosomes 9 and 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired immune function and die at 6 to 7 weeks of age from kidney failure associated with podocyte defects and mesangial cell hyperplasia. Heterozygotes develop glomerular changes around 9 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik T C 1: 181,055,131 F153L possibly damaging Het
A1bg T A 15: 60,919,732 D92V probably damaging Het
Ankrd52 C A 10: 128,386,452 T583K probably benign Het
C3ar1 C T 6: 122,850,851 V136M probably damaging Het
Capg A G 6: 72,561,043 E304G possibly damaging Het
Ccdc125 A C 13: 100,684,338 N189T possibly damaging Het
Ccr5 T C 9: 124,124,621 F87S probably damaging Het
Cdt1 C T 8: 122,572,566 T529M probably benign Het
Cfap126 A G 1: 171,125,784 D49G possibly damaging Het
Cngb3 T C 4: 19,396,685 I346T probably benign Het
Dgkd A G 1: 87,881,881 D97G probably damaging Het
Dgkg A T 16: 22,565,364 probably null Het
Dmbx1 G T 4: 115,918,024 T358K probably damaging Het
Epc2 A T 2: 49,522,525 K172* probably null Het
F2rl2 A T 13: 95,700,909 N154I probably damaging Het
Fyttd1 G A 16: 32,905,554 R175Q probably damaging Het
Gbp5 T A 3: 142,506,735 C395S probably damaging Het
Gen1 T C 12: 11,241,641 N716D probably benign Het
Helz2 A G 2: 181,240,511 L163P probably damaging Het
Hmox2 T A 16: 4,765,033 L210Q probably damaging Het
Klhl28 T C 12: 64,957,302 T146A probably benign Het
Lrrk2 T C 15: 91,802,045 probably benign Het
Man2c1 T A 9: 57,139,701 M580K probably benign Het
Neb G A 2: 52,287,156 A1391V probably damaging Het
Nyap2 T C 1: 81,241,951 S563P probably damaging Het
Olfr1301 A G 2: 111,754,774 D175G probably damaging Het
Olfr520 T C 7: 99,736,049 V302A probably damaging Het
Olfr543 A G 7: 102,477,477 I131T probably damaging Het
P2rx5 T A 11: 73,167,062 probably benign Het
Pclo C T 5: 14,680,451 probably benign Het
Pex1 G A 5: 3,626,141 probably benign Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Psma8 A G 18: 14,726,530 I86V possibly damaging Het
Ptpdc1 G T 13: 48,586,919 Y345* probably null Het
Rcbtb1 G T 14: 59,235,242 K493N probably benign Het
Rexo2 A T 9: 48,474,447 S126T probably benign Het
Rorc T A 3: 94,377,613 probably benign Het
Slc7a2 T C 8: 40,911,028 L426P probably damaging Het
Syde1 T C 10: 78,590,034 T100A probably benign Het
Tbc1d20 A T 2: 152,311,781 Q342L probably benign Het
Thbs1 A G 2: 118,113,350 T150A possibly damaging Het
Trpm1 A G 7: 64,248,222 H317R probably damaging Het
Tut1 T A 19: 8,962,447 L265Q possibly damaging Het
Wdfy4 A G 14: 33,107,173 F1029L possibly damaging Het
Wdr63 T C 3: 146,081,423 probably null Het
Wdr7 A G 18: 63,904,101 T1199A probably benign Het
Zfp458 A G 13: 67,258,090 V95A possibly damaging Het
Zscan18 A T 7: 12,769,417 F738L possibly damaging Het
Other mutations in Cd2ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Cd2ap APN 17 42808785 missense probably benign 0.16
IGL00909:Cd2ap APN 17 42830114 splice site probably benign
IGL01321:Cd2ap APN 17 42845389 missense possibly damaging 0.71
IGL01350:Cd2ap APN 17 42825921 nonsense probably null
IGL01485:Cd2ap APN 17 42852474 missense probably damaging 1.00
IGL01834:Cd2ap APN 17 42826360 critical splice acceptor site probably null
IGL01834:Cd2ap APN 17 42826361 critical splice acceptor site probably null
PIT4494001:Cd2ap UTSW 17 42852367 critical splice donor site probably null
R0331:Cd2ap UTSW 17 42805301 missense probably benign 0.06
R0674:Cd2ap UTSW 17 42845392 missense possibly damaging 0.89
R1471:Cd2ap UTSW 17 42820597 missense probably benign 0.00
R1806:Cd2ap UTSW 17 42838758 nonsense probably null
R3858:Cd2ap UTSW 17 42816572 nonsense probably null
R3911:Cd2ap UTSW 17 42816089 critical splice acceptor site probably null
R3941:Cd2ap UTSW 17 42808799 missense probably damaging 0.99
R4766:Cd2ap UTSW 17 42852459 missense probably damaging 0.99
R5024:Cd2ap UTSW 17 42805345 splice site probably null
R5045:Cd2ap UTSW 17 42807960 missense probably benign 0.01
R6051:Cd2ap UTSW 17 42796328 makesense probably null
R6063:Cd2ap UTSW 17 42825911 missense probably benign 0.00
R7034:Cd2ap UTSW 17 42798599 missense probably damaging 1.00
R7036:Cd2ap UTSW 17 42798599 missense probably damaging 1.00
R7214:Cd2ap UTSW 17 42845394 missense possibly damaging 0.61
R7299:Cd2ap UTSW 17 42830013 nonsense probably null
R7301:Cd2ap UTSW 17 42830013 nonsense probably null
R7402:Cd2ap UTSW 17 42805163 missense possibly damaging 0.88
R7851:Cd2ap UTSW 17 42824472 critical splice donor site probably null
R7934:Cd2ap UTSW 17 42824472 critical splice donor site probably null
Z1088:Cd2ap UTSW 17 42807993 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTTACTTTATGAGAGCGGCTGAGC -3'
(R):5'- TGTCCACAGCAGTAAACAGCAGG -3'

Sequencing Primer
(F):5'- ggagatggaggcaggagg -3'
(R):5'- CCTTGAAGCTACCAAAAGAAGATG -3'
Posted On2013-08-06