Incidental Mutation 'R7937:Gpatch3'
ID 648795
Institutional Source Beutler Lab
Gene Symbol Gpatch3
Ensembl Gene ENSMUSG00000028850
Gene Name G patch domain containing 3
Synonyms Gpatc3, D930035B09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R7937 (G1)
Quality Score 180.009
Status Not validated
Chromosome 4
Chromosomal Location 133574745-133584243 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 133582997 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 418 (V418L)
Ref Sequence ENSEMBL: ENSMUSP00000030662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030661] [ENSMUST00000030662] [ENSMUST00000105899]
AlphaFold Q8BIY1
Predicted Effect probably benign
Transcript: ENSMUST00000030661
SMART Domains Protein: ENSMUSP00000030661
Gene: ENSMUSG00000028848

DomainStartEndE-ValueType
Pfam:ATP_bind_1 14 261 6.6e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000030662
AA Change: V418L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030662
Gene: ENSMUSG00000028850
AA Change: V418L

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
low complexity region 274 305 N/A INTRINSIC
G_patch 409 457 1.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105899
SMART Domains Protein: ENSMUSP00000101519
Gene: ENSMUSG00000028848

DomainStartEndE-ValueType
Pfam:ATP_bind_1 14 117 9.2e-42 PFAM
Pfam:ATP_bind_1 115 238 4.3e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,331,011 W32R possibly damaging Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Ano6 C A 15: 95,972,589 T875K probably damaging Het
Armc8 G A 9: 99,536,219 T94I probably damaging Het
Ash1l C T 3: 89,070,317 R2685* probably null Het
Bri3bp A T 5: 125,454,331 N114Y probably damaging Het
Camkk2 G T 5: 122,764,034 Q71K probably benign Het
Cc2d2b T C 19: 40,777,292 F49S Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Chd8 A G 14: 52,227,506 F633L probably benign Het
Cntn5 G A 9: 9,748,445 T477I probably damaging Het
Cyp2c37 T A 19: 39,993,758 Y68N probably damaging Het
Dnah2 A T 11: 69,517,685 L53* probably null Het
Dnajc11 A G 4: 151,950,452 D44G probably damaging Het
Elovl3 T C 19: 46,134,729 F248S probably damaging Het
Etfdh A G 3: 79,609,816 L422P probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fgd4 A G 16: 16,469,773 Y355H probably damaging Het
Fgfr2 A G 7: 130,219,093 M237T probably damaging Het
Gdap1 A T 1: 17,159,953 K203N probably benign Het
Glis1 A G 4: 107,627,526 D594G possibly damaging Het
Gm4787 T A 12: 81,377,905 H493L probably benign Het
Greb1 T C 12: 16,716,669 N376S probably damaging Het
Hspg2 A G 4: 137,550,932 Q3010R probably benign Het
Ice2 T A 9: 69,410,785 F223I possibly damaging Het
March11 A G 15: 26,409,237 T341A probably damaging Het
Mllt10 A G 2: 18,206,084 K770E probably damaging Het
Mug1 A G 6: 121,861,169 T453A probably benign Het
Myh15 C T 16: 49,155,646 T1359I probably benign Het
Nbn A G 4: 15,958,080 K3E probably damaging Het
Nlrp4a T C 7: 26,464,146 F913L probably benign Het
Nlrx1 G T 9: 44,264,789 A48D probably damaging Het
Noc3l C G 19: 38,795,003 G643A possibly damaging Het
Olfr1307 T C 2: 111,944,530 R309G probably benign Het
Olfr895 T A 9: 38,269,048 N170K probably benign Het
Pde6b G T 5: 108,419,773 probably null Het
Phactr1 A G 13: 43,077,729 I247V unknown Het
Pid1 G T 1: 84,116,024 Q48K probably benign Het
Ppfia2 A G 10: 106,863,372 N794S probably benign Het
Ppox G A 1: 171,279,972 S123L possibly damaging Het
Ptprd A C 4: 76,095,535 D778E probably benign Het
Rgs13 A G 1: 144,140,862 Y48H probably damaging Het
Rgs17 T A 10: 5,833,078 M190L probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Scaf8 C T 17: 3,197,207 P935L probably damaging Het
Slc17a2 A G 13: 23,812,665 H51R probably benign Het
Slc22a6 T C 19: 8,623,889 I435T probably benign Het
Snx4 T C 16: 33,291,829 L378P probably damaging Het
Spns1 A G 7: 126,374,054 L155P probably damaging Het
St8sia4 T C 1: 95,653,595 T141A possibly damaging Het
Syt10 A T 15: 89,782,617 S510R probably damaging Het
Tmprss11d A T 5: 86,309,490 F241L probably benign Het
Tnfrsf21 A T 17: 43,037,925 T143S probably benign Het
Trim72 A G 7: 128,010,319 N431S probably benign Het
Usp43 A G 11: 67,855,789 S1031P probably damaging Het
Wdr75 A G 1: 45,819,639 Y656C probably benign Het
Zfp28 T C 7: 6,393,786 C407R probably damaging Het
Zfp804b C T 5: 6,771,866 R399Q possibly damaging Het
Zfp949 T A 9: 88,569,270 C298S probably damaging Het
Other mutations in Gpatch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Gpatch3 APN 4 133580717 unclassified probably benign
IGL02876:Gpatch3 APN 4 133580684 missense probably damaging 1.00
IGL03181:Gpatch3 APN 4 133578122 missense probably damaging 1.00
ANU23:Gpatch3 UTSW 4 133578302 small deletion probably benign
PIT4585001:Gpatch3 UTSW 4 133583086 missense probably damaging 0.99
R0358:Gpatch3 UTSW 4 133577904 splice site probably null
R0383:Gpatch3 UTSW 4 133578146 missense probably damaging 1.00
R1706:Gpatch3 UTSW 4 133575173 nonsense probably null
R2269:Gpatch3 UTSW 4 133583807 missense possibly damaging 0.83
R3788:Gpatch3 UTSW 4 133575168 missense possibly damaging 0.93
R4030:Gpatch3 UTSW 4 133578147 missense possibly damaging 0.94
R4334:Gpatch3 UTSW 4 133582481 missense probably damaging 1.00
R4718:Gpatch3 UTSW 4 133582544 missense probably benign 0.37
R5036:Gpatch3 UTSW 4 133578150 missense probably damaging 1.00
R6032:Gpatch3 UTSW 4 133578306 missense probably benign 0.06
R6032:Gpatch3 UTSW 4 133578306 missense probably benign 0.06
R6572:Gpatch3 UTSW 4 133574880 missense probably damaging 1.00
R6923:Gpatch3 UTSW 4 133582525 missense probably damaging 1.00
R7106:Gpatch3 UTSW 4 133578203 missense probably benign 0.05
R7572:Gpatch3 UTSW 4 133574806 missense probably benign 0.01
R7737:Gpatch3 UTSW 4 133575096 missense probably benign 0.01
R8300:Gpatch3 UTSW 4 133579829 missense probably damaging 1.00
R9541:Gpatch3 UTSW 4 133578284 missense probably benign 0.01
RF025:Gpatch3 UTSW 4 133578310 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATTCCTCCTGCTCCAAGGAG -3'
(R):5'- TCATTTAGAGGGGCCCACAC -3'

Sequencing Primer
(F):5'- TAGGCTGGCCTTGAACTCAGAAATC -3'
(R):5'- CCTCAAAACAATGGCAAGAGG -3'
Posted On 2020-09-15