Incidental Mutation 'R7937:Dnajc11'
ID648797
Institutional Source Beutler Lab
Gene Symbol Dnajc11
Ensembl Gene ENSMUSG00000039768
Gene NameDnaJ heat shock protein family (Hsp40) member C11
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R7937 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location151933691-151982137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151950452 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 44 (D44G)
Ref Sequence ENSEMBL: ENSMUSP00000051643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062904] [ENSMUST00000139069] [ENSMUST00000147625]
Predicted Effect probably damaging
Transcript: ENSMUST00000062904
AA Change: D44G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051643
Gene: ENSMUSG00000039768
AA Change: D44G

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
Pfam:DUF3395 410 549 2e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139069
AA Change: D44G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119604
Gene: ENSMUSG00000039768
AA Change: D44G

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
coiled coil region 318 349 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147625
AA Change: D6G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122140
Gene: ENSMUSG00000039768
AA Change: D6G

DomainStartEndE-ValueType
DnaJ 1 36 2.51e-1 SMART
low complexity region 64 84 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit motor neuron pathology, disorganized cristae and lymphoid abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,331,011 W32R possibly damaging Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Ano6 C A 15: 95,972,589 T875K probably damaging Het
Armc8 G A 9: 99,536,219 T94I probably damaging Het
Ash1l C T 3: 89,070,317 R2685* probably null Het
Bri3bp A T 5: 125,454,331 N114Y probably damaging Het
Camkk2 G T 5: 122,764,034 Q71K probably benign Het
Cc2d2b T C 19: 40,777,292 F49S Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Chd8 A G 14: 52,227,506 F633L probably benign Het
Cntn5 G A 9: 9,748,445 T477I probably damaging Het
Cyp2c37 T A 19: 39,993,758 Y68N probably damaging Het
Dnah2 A T 11: 69,517,685 L53* probably null Het
Elovl3 T C 19: 46,134,729 F248S probably damaging Het
Etfdh A G 3: 79,609,816 L422P probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fgd4 A G 16: 16,469,773 Y355H probably damaging Het
Fgfr2 A G 7: 130,219,093 M237T probably damaging Het
Gdap1 A T 1: 17,159,953 K203N probably benign Het
Glis1 A G 4: 107,627,526 D594G possibly damaging Het
Gm4787 T A 12: 81,377,905 H493L probably benign Het
Gpatch3 G T 4: 133,582,997 V418L probably damaging Het
Greb1 T C 12: 16,716,669 N376S probably damaging Het
Hspg2 A G 4: 137,550,932 Q3010R probably benign Het
Ice2 T A 9: 69,410,785 F223I possibly damaging Het
March11 A G 15: 26,409,237 T341A probably damaging Het
Mllt10 A G 2: 18,206,084 K770E probably damaging Het
Mug1 A G 6: 121,861,169 T453A probably benign Het
Myh15 C T 16: 49,155,646 T1359I probably benign Het
Nbn A G 4: 15,958,080 K3E probably damaging Het
Nlrp4a T C 7: 26,464,146 F913L probably benign Het
Nlrx1 G T 9: 44,264,789 A48D probably damaging Het
Noc3l C G 19: 38,795,003 G643A possibly damaging Het
Olfr1307 T C 2: 111,944,530 R309G probably benign Het
Olfr895 T A 9: 38,269,048 N170K probably benign Het
Pde6b G T 5: 108,419,773 probably null Het
Phactr1 A G 13: 43,077,729 I247V unknown Het
Pid1 G T 1: 84,116,024 Q48K probably benign Het
Ppfia2 A G 10: 106,863,372 N794S probably benign Het
Ppox G A 1: 171,279,972 S123L possibly damaging Het
Ptprd A C 4: 76,095,535 D778E probably benign Het
Rgs13 A G 1: 144,140,862 Y48H probably damaging Het
Rgs17 T A 10: 5,833,078 M190L probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Scaf8 C T 17: 3,197,207 P935L probably damaging Het
Slc17a2 A G 13: 23,812,665 H51R probably benign Het
Slc22a6 T C 19: 8,623,889 I435T probably benign Het
Snx4 T C 16: 33,291,829 L378P probably damaging Het
Spns1 A G 7: 126,374,054 L155P probably damaging Het
St8sia4 T C 1: 95,653,595 T141A possibly damaging Het
Syt10 A T 15: 89,782,617 S510R probably damaging Het
Tmprss11d A T 5: 86,309,490 F241L probably benign Het
Tnfrsf21 A T 17: 43,037,925 T143S probably benign Het
Trim72 A G 7: 128,010,319 N431S probably benign Het
Usp43 A G 11: 67,855,789 S1031P probably damaging Het
Wdr75 A G 1: 45,819,639 Y656C probably benign Het
Zfp28 T C 7: 6,393,786 C407R probably damaging Het
Zfp804b C T 5: 6,771,866 R399Q possibly damaging Het
Zfp949 T A 9: 88,569,270 C298S probably damaging Het
Other mutations in Dnajc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Dnajc11 APN 4 151979302 missense probably damaging 0.99
IGL02253:Dnajc11 APN 4 151950519 nonsense probably null
IGL02606:Dnajc11 APN 4 151979484 missense probably benign 0.18
IGL02969:Dnajc11 APN 4 151978046 missense probably benign 0.33
IGL03062:Dnajc11 APN 4 151970861 missense possibly damaging 0.92
PIT4812001:Dnajc11 UTSW 4 151952889 missense probably benign 0.04
R0601:Dnajc11 UTSW 4 151969936 missense probably damaging 1.00
R0620:Dnajc11 UTSW 4 151973628 missense possibly damaging 0.54
R0639:Dnajc11 UTSW 4 151969936 missense probably damaging 1.00
R1694:Dnajc11 UTSW 4 151979273 missense probably damaging 1.00
R4091:Dnajc11 UTSW 4 151978093 unclassified probably benign
R4545:Dnajc11 UTSW 4 151979941 missense probably damaging 1.00
R4548:Dnajc11 UTSW 4 151973617 missense possibly damaging 0.93
R4720:Dnajc11 UTSW 4 151968539 missense probably damaging 1.00
R4732:Dnajc11 UTSW 4 151970967 unclassified probably benign
R4751:Dnajc11 UTSW 4 151968542 missense probably benign 0.01
R4895:Dnajc11 UTSW 4 151979933 missense probably damaging 1.00
R5122:Dnajc11 UTSW 4 151976997 missense possibly damaging 0.63
R5127:Dnajc11 UTSW 4 151969814 unclassified probably benign
R5174:Dnajc11 UTSW 4 151979984 missense probably damaging 1.00
R5180:Dnajc11 UTSW 4 151969939 missense probably damaging 1.00
R5319:Dnajc11 UTSW 4 151968526 missense probably damaging 1.00
R5624:Dnajc11 UTSW 4 151979510 missense probably benign
R6056:Dnajc11 UTSW 4 151978126 unclassified probably benign
R6434:Dnajc11 UTSW 4 151979294 missense probably damaging 1.00
R7635:Dnajc11 UTSW 4 151968611 missense probably damaging 1.00
R7652:Dnajc11 UTSW 4 151974225 missense probably damaging 0.99
R7940:Dnajc11 UTSW 4 151968588 missense probably benign 0.00
R8093:Dnajc11 UTSW 4 151969900 missense probably damaging 1.00
R8361:Dnajc11 UTSW 4 151970911 missense probably damaging 0.99
Z1176:Dnajc11 UTSW 4 151933783 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTTGATTATGTCCTGTGCGG -3'
(R):5'- TTTCAAAGGGCGCTGTCAG -3'

Sequencing Primer
(F):5'- ATTATGTCCTGTGCGGAGGGC -3'
(R):5'- GCGCTGTCAGTAAAAGGTACC -3'
Posted On2020-09-15