Incidental Mutation 'R7937:Tmprss11d'
ID648799
Institutional Source Beutler Lab
Gene Symbol Tmprss11d
Ensembl Gene ENSMUSG00000061259
Gene Nametransmembrane protease, serine 11d
SynonymsAsP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7937 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location86302217-86373420 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86309490 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 241 (F241L)
Ref Sequence ENSEMBL: ENSMUSP00000031175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031175] [ENSMUST00000122377]
PDB Structure
Crystal structure of SEA domain of transmembrane protease from Mus musculus [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000031175
AA Change: F241L

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031175
Gene: ENSMUSG00000061259
AA Change: F241L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
SEA 41 164 4.92e-2 SMART
Tryp_SPc 185 411 1.29e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122377
AA Change: F103L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113079
Gene: ENSMUSG00000061259
AA Change: F103L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 47 273 1.29e-86 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a trypsin-like serine protease released from the submucosal serous glands onto mucous membrane. It is a type II integral membrane protein and has 29-38% identity in the sequence of the catalytic region with human hepsin, enteropeptidase, acrosin, and mast cell tryptase. The noncatalytic region has little similarity to other known proteins. This protein may play some biological role in the host defense system on the mucous membrane independently of or in cooperation with other substances in airway mucous or bronchial secretions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Aged female mice homozygous for a knock-in allele exhibit increased lymphoma incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,331,011 W32R possibly damaging Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Ano6 C A 15: 95,972,589 T875K probably damaging Het
Armc8 G A 9: 99,536,219 T94I probably damaging Het
Ash1l C T 3: 89,070,317 R2685* probably null Het
Bri3bp A T 5: 125,454,331 N114Y probably damaging Het
Camkk2 G T 5: 122,764,034 Q71K probably benign Het
Cc2d2b T C 19: 40,777,292 F49S Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Chd8 A G 14: 52,227,506 F633L probably benign Het
Cntn5 G A 9: 9,748,445 T477I probably damaging Het
Cyp2c37 T A 19: 39,993,758 Y68N probably damaging Het
Dnah2 A T 11: 69,517,685 L53* probably null Het
Dnajc11 A G 4: 151,950,452 D44G probably damaging Het
Elovl3 T C 19: 46,134,729 F248S probably damaging Het
Etfdh A G 3: 79,609,816 L422P probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fgd4 A G 16: 16,469,773 Y355H probably damaging Het
Fgfr2 A G 7: 130,219,093 M237T probably damaging Het
Gdap1 A T 1: 17,159,953 K203N probably benign Het
Glis1 A G 4: 107,627,526 D594G possibly damaging Het
Gm4787 T A 12: 81,377,905 H493L probably benign Het
Gpatch3 G T 4: 133,582,997 V418L probably damaging Het
Greb1 T C 12: 16,716,669 N376S probably damaging Het
Hspg2 A G 4: 137,550,932 Q3010R probably benign Het
Ice2 T A 9: 69,410,785 F223I possibly damaging Het
March11 A G 15: 26,409,237 T341A probably damaging Het
Mllt10 A G 2: 18,206,084 K770E probably damaging Het
Mug1 A G 6: 121,861,169 T453A probably benign Het
Myh15 C T 16: 49,155,646 T1359I probably benign Het
Nbn A G 4: 15,958,080 K3E probably damaging Het
Nlrp4a T C 7: 26,464,146 F913L probably benign Het
Nlrx1 G T 9: 44,264,789 A48D probably damaging Het
Noc3l C G 19: 38,795,003 G643A possibly damaging Het
Olfr1307 T C 2: 111,944,530 R309G probably benign Het
Olfr895 T A 9: 38,269,048 N170K probably benign Het
Pde6b G T 5: 108,419,773 probably null Het
Phactr1 A G 13: 43,077,729 I247V unknown Het
Pid1 G T 1: 84,116,024 Q48K probably benign Het
Ppfia2 A G 10: 106,863,372 N794S probably benign Het
Ppox G A 1: 171,279,972 S123L possibly damaging Het
Ptprd A C 4: 76,095,535 D778E probably benign Het
Rgs13 A G 1: 144,140,862 Y48H probably damaging Het
Rgs17 T A 10: 5,833,078 M190L probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Scaf8 C T 17: 3,197,207 P935L probably damaging Het
Slc17a2 A G 13: 23,812,665 H51R probably benign Het
Slc22a6 T C 19: 8,623,889 I435T probably benign Het
Snx4 T C 16: 33,291,829 L378P probably damaging Het
Spns1 A G 7: 126,374,054 L155P probably damaging Het
St8sia4 T C 1: 95,653,595 T141A possibly damaging Het
Syt10 A T 15: 89,782,617 S510R probably damaging Het
Tnfrsf21 A T 17: 43,037,925 T143S probably benign Het
Trim72 A G 7: 128,010,319 N431S probably benign Het
Usp43 A G 11: 67,855,789 S1031P probably damaging Het
Wdr75 A G 1: 45,819,639 Y656C probably benign Het
Zfp28 T C 7: 6,393,786 C407R probably damaging Het
Zfp804b C T 5: 6,771,866 R399Q possibly damaging Het
Zfp949 T A 9: 88,569,270 C298S probably damaging Het
Other mutations in Tmprss11d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02393:Tmprss11d APN 5 86303612 makesense probably null
IGL02519:Tmprss11d APN 5 86306305 missense probably damaging 1.00
IGL02666:Tmprss11d APN 5 86331193 missense probably damaging 1.00
IGL02974:Tmprss11d APN 5 86306376 missense probably damaging 1.00
IGL03305:Tmprss11d APN 5 86326420 missense probably damaging 1.00
R0440:Tmprss11d UTSW 5 86338812 missense probably damaging 0.96
R1261:Tmprss11d UTSW 5 86309380 missense possibly damaging 0.52
R1544:Tmprss11d UTSW 5 86338799 missense probably damaging 1.00
R2018:Tmprss11d UTSW 5 86339554 missense probably damaging 0.97
R2036:Tmprss11d UTSW 5 86309269 missense probably damaging 0.97
R2267:Tmprss11d UTSW 5 86373349 missense probably benign 0.01
R4063:Tmprss11d UTSW 5 86309318 missense probably benign 0.04
R4087:Tmprss11d UTSW 5 86309279 missense probably damaging 1.00
R4665:Tmprss11d UTSW 5 86309401 missense probably damaging 1.00
R4666:Tmprss11d UTSW 5 86309401 missense probably damaging 1.00
R4784:Tmprss11d UTSW 5 86306281 missense probably damaging 0.99
R4785:Tmprss11d UTSW 5 86306281 missense probably damaging 0.99
R5077:Tmprss11d UTSW 5 86309263 critical splice donor site probably null
R5201:Tmprss11d UTSW 5 86309355 missense possibly damaging 0.92
R5350:Tmprss11d UTSW 5 86338887 missense probably benign 0.08
R5523:Tmprss11d UTSW 5 86338870 missense probably benign 0.05
R5618:Tmprss11d UTSW 5 86306295 missense probably benign
R5643:Tmprss11d UTSW 5 86326529 missense probably benign 0.00
R5834:Tmprss11d UTSW 5 86306310 missense probably damaging 1.00
R6422:Tmprss11d UTSW 5 86309425 missense probably damaging 1.00
R6706:Tmprss11d UTSW 5 86331103 missense probably benign 0.03
R6735:Tmprss11d UTSW 5 86309300 missense probably damaging 1.00
R6778:Tmprss11d UTSW 5 86309350 missense probably benign 0.34
R7013:Tmprss11d UTSW 5 86326573 missense probably damaging 0.99
R7273:Tmprss11d UTSW 5 86337239 missense probably damaging 1.00
R7488:Tmprss11d UTSW 5 86326450 missense probably damaging 1.00
R7627:Tmprss11d UTSW 5 86309506 missense possibly damaging 0.73
R7742:Tmprss11d UTSW 5 86303634 missense probably damaging 0.98
R8419:Tmprss11d UTSW 5 86309306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACATATGCGACAGAACCAGG -3'
(R):5'- GCAAACATTCATGGGATGTTGG -3'

Sequencing Primer
(F):5'- CGACAGAACCAGGGATGATATTTTG -3'
(R):5'- TGTTGGTGGTAAATACAAAACACAG -3'
Posted On2020-09-15