Incidental Mutation 'R0014:Wdr7'
ID64880
Institutional Source Beutler Lab
Gene Symbol Wdr7
Ensembl Gene ENSMUSG00000040560
Gene NameWD repeat domain 7
SynonymsTGF-beta resistance associated gene, TRAG
MMRRC Submission 038309-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R0014 (G1)
Quality Score89
Status Validated
Chromosome18
Chromosomal Location63708695-63989760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63904101 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1199 (T1199A)
Ref Sequence ENSEMBL: ENSMUSP00000072509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072726]
Predicted Effect probably benign
Transcript: ENSMUST00000072726
AA Change: T1199A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000072509
Gene: ENSMUSG00000040560
AA Change: T1199A

DomainStartEndE-ValueType
WD40 5 47 1.2e-2 SMART
WD40 53 95 3.71e-1 SMART
Blast:WD40 145 190 1e-18 BLAST
WD40 208 242 1.77e2 SMART
WD40 453 498 3.81e-5 SMART
WD40 501 546 4.26e1 SMART
WD40 549 588 1.63e-4 SMART
low complexity region 760 777 N/A INTRINSIC
low complexity region 915 927 N/A INTRINSIC
low complexity region 956 970 N/A INTRINSIC
low complexity region 1020 1040 N/A INTRINSIC
low complexity region 1181 1192 N/A INTRINSIC
Blast:WD40 1341 1380 5e-20 BLAST
WD40 1382 1422 2.73e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122693
Meta Mutation Damage Score 0.1175 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) that may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein forms the beta subunit of rabconnectin-3 and binds directly with Rab3A GDP/GTP exchange protein and indirectly with Rab3A GDP/GTP activating protein; these proteins are regulators of Rab3 small G protein family members involved in control of the calcium-dependant exocytosis of neurotransmitters. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130409I23Rik T C 1: 181,055,131 F153L possibly damaging Het
A1bg T A 15: 60,919,732 D92V probably damaging Het
Ankrd52 C A 10: 128,386,452 T583K probably benign Het
C3ar1 C T 6: 122,850,851 V136M probably damaging Het
Capg A G 6: 72,561,043 E304G possibly damaging Het
Ccdc125 A C 13: 100,684,338 N189T possibly damaging Het
Ccr5 T C 9: 124,124,621 F87S probably damaging Het
Cd2ap T C 17: 42,807,928 S540G probably benign Het
Cdt1 C T 8: 122,572,566 T529M probably benign Het
Cfap126 A G 1: 171,125,784 D49G possibly damaging Het
Cngb3 T C 4: 19,396,685 I346T probably benign Het
Dgkd A G 1: 87,881,881 D97G probably damaging Het
Dgkg A T 16: 22,565,364 probably null Het
Dmbx1 G T 4: 115,918,024 T358K probably damaging Het
Epc2 A T 2: 49,522,525 K172* probably null Het
F2rl2 A T 13: 95,700,909 N154I probably damaging Het
Fyttd1 G A 16: 32,905,554 R175Q probably damaging Het
Gbp5 T A 3: 142,506,735 C395S probably damaging Het
Gen1 T C 12: 11,241,641 N716D probably benign Het
Helz2 A G 2: 181,240,511 L163P probably damaging Het
Hmox2 T A 16: 4,765,033 L210Q probably damaging Het
Klhl28 T C 12: 64,957,302 T146A probably benign Het
Lrrk2 T C 15: 91,802,045 probably benign Het
Man2c1 T A 9: 57,139,701 M580K probably benign Het
Neb G A 2: 52,287,156 A1391V probably damaging Het
Nyap2 T C 1: 81,241,951 S563P probably damaging Het
Olfr1301 A G 2: 111,754,774 D175G probably damaging Het
Olfr520 T C 7: 99,736,049 V302A probably damaging Het
Olfr543 A G 7: 102,477,477 I131T probably damaging Het
P2rx5 T A 11: 73,167,062 probably benign Het
Pclo C T 5: 14,680,451 probably benign Het
Pex1 G A 5: 3,626,141 probably benign Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Psma8 A G 18: 14,726,530 I86V possibly damaging Het
Ptpdc1 G T 13: 48,586,919 Y345* probably null Het
Rcbtb1 G T 14: 59,235,242 K493N probably benign Het
Rexo2 A T 9: 48,474,447 S126T probably benign Het
Rorc T A 3: 94,377,613 probably benign Het
Slc7a2 T C 8: 40,911,028 L426P probably damaging Het
Syde1 T C 10: 78,590,034 T100A probably benign Het
Tbc1d20 A T 2: 152,311,781 Q342L probably benign Het
Thbs1 A G 2: 118,113,350 T150A possibly damaging Het
Trpm1 A G 7: 64,248,222 H317R probably damaging Het
Tut1 T A 19: 8,962,447 L265Q possibly damaging Het
Wdfy4 A G 14: 33,107,173 F1029L possibly damaging Het
Wdr63 T C 3: 146,081,423 probably null Het
Zfp458 A G 13: 67,258,090 V95A possibly damaging Het
Zscan18 A T 7: 12,769,417 F738L possibly damaging Het
Other mutations in Wdr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Wdr7 APN 18 63720775 missense possibly damaging 0.83
IGL00708:Wdr7 APN 18 63778033 missense probably benign 0.42
IGL00813:Wdr7 APN 18 63735604 missense possibly damaging 0.84
IGL00840:Wdr7 APN 18 63927327 missense possibly damaging 0.80
IGL00904:Wdr7 APN 18 63796231 missense probably benign 0.43
IGL00930:Wdr7 APN 18 63740244 nonsense probably null
IGL01481:Wdr7 APN 18 63739179 missense probably damaging 1.00
IGL02121:Wdr7 APN 18 63777545 nonsense probably null
IGL02346:Wdr7 APN 18 63865336 missense probably benign 0.09
IGL02454:Wdr7 APN 18 63796228 missense probably benign 0.20
IGL02538:Wdr7 APN 18 63796235 missense probably benign 0.01
IGL02870:Wdr7 APN 18 63791843 missense probably benign
IGL03054:Wdr7 APN 18 63825121 splice site probably benign
IGL03189:Wdr7 APN 18 63760601 missense probably benign 0.17
R0022:Wdr7 UTSW 18 63777634 missense probably damaging 1.00
R0233:Wdr7 UTSW 18 63904101 missense probably benign 0.03
R0432:Wdr7 UTSW 18 63796249 missense probably damaging 0.96
R0496:Wdr7 UTSW 18 63791843 missense probably benign
R0633:Wdr7 UTSW 18 63865300 missense probably benign 0.00
R0931:Wdr7 UTSW 18 63865300 missense probably benign 0.00
R1585:Wdr7 UTSW 18 63924918 missense probably benign 0.03
R1651:Wdr7 UTSW 18 63720776 nonsense probably null
R1804:Wdr7 UTSW 18 63865440 missense probably damaging 1.00
R1874:Wdr7 UTSW 18 63728504 missense probably benign 0.02
R1985:Wdr7 UTSW 18 63760583 frame shift probably null
R2106:Wdr7 UTSW 18 63778038 missense probably damaging 1.00
R2206:Wdr7 UTSW 18 63777607 missense possibly damaging 0.95
R2207:Wdr7 UTSW 18 63777607 missense possibly damaging 0.95
R2245:Wdr7 UTSW 18 63924909 missense possibly damaging 0.60
R2407:Wdr7 UTSW 18 63760723 missense probably benign
R3804:Wdr7 UTSW 18 63720836 missense probably benign
R3880:Wdr7 UTSW 18 63724155 missense possibly damaging 0.92
R4410:Wdr7 UTSW 18 63778249 missense probably damaging 1.00
R4441:Wdr7 UTSW 18 63755210 missense probably damaging 1.00
R4485:Wdr7 UTSW 18 63777550 missense possibly damaging 0.89
R4606:Wdr7 UTSW 18 63779945 nonsense probably null
R4607:Wdr7 UTSW 18 63777580 missense probably benign 0.28
R4608:Wdr7 UTSW 18 63777580 missense probably benign 0.28
R4711:Wdr7 UTSW 18 63728465 missense probably benign
R4852:Wdr7 UTSW 18 63777949 missense probably damaging 0.98
R5197:Wdr7 UTSW 18 63738866 missense probably benign 0.02
R5213:Wdr7 UTSW 18 63755126 missense probably damaging 1.00
R5280:Wdr7 UTSW 18 63987312 missense probably benign 0.35
R5378:Wdr7 UTSW 18 63825239 critical splice donor site probably null
R6076:Wdr7 UTSW 18 63739277 missense probably damaging 1.00
R6083:Wdr7 UTSW 18 63728469 missense probably damaging 1.00
R6168:Wdr7 UTSW 18 63777977 missense probably damaging 0.98
R6234:Wdr7 UTSW 18 63724132 missense probably damaging 1.00
R6295:Wdr7 UTSW 18 63755111 missense probably damaging 1.00
R6548:Wdr7 UTSW 18 63778251 missense possibly damaging 0.87
R6566:Wdr7 UTSW 18 63755055 missense possibly damaging 0.72
R6696:Wdr7 UTSW 18 63739330 missense probably benign 0.07
R6937:Wdr7 UTSW 18 63791867 missense probably benign
R6962:Wdr7 UTSW 18 63865288 missense possibly damaging 0.74
R7162:Wdr7 UTSW 18 63724139 missense possibly damaging 0.92
R7376:Wdr7 UTSW 18 63777620 missense probably damaging 1.00
R7423:Wdr7 UTSW 18 63777380 intron probably null
R7781:Wdr7 UTSW 18 63777789 nonsense probably null
R7851:Wdr7 UTSW 18 63720327 missense probably benign 0.05
R7934:Wdr7 UTSW 18 63720327 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GCCCTTCTACGGACCTTACCTCTAAAG -3'
(R):5'- TGCTGATTAAACACCCTGAGTTTCTGG -3'

Sequencing Primer
(F):5'- CCTCTAAAGTCAAGTCTCACTGATG -3'
(R):5'- TTCTGGAGGATAACCAACACC -3'
Posted On2013-08-06