Mutagenetix > Incidental Mutation

Incidental Mutation 'R7937:Pde6b'

648800

Institutional Source

Beutler Lab

Gene Symbol

Pde6b

Ensembl Gene

ENSMUSG00000029491

Gene Name

phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide

Synonyms

rd10, Pdeb, rd, rd1, r

MMRRC Submission

Accession Numbers

Genbank: NM_008806; MGI: 97525

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7937 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108388391-108432397 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to T at 108419773 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000031456 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031456]

AlphaFold

P23440

Predicted Effect

probably null
Transcript: ENSMUST00000031456

SMART Domains

Protein: ENSMUSP00000031456
Gene: ENSMUSG00000029491

Domain	Start	End	E-Value	Type
GAF	71	230	1.29e-27	SMART
GAF	252	439	5.76e-25	SMART
Blast:HDc	484	538	1e-24	BLAST
HDc	554	732	1.25e-9	SMART
Blast:HDc	757	792	8e-13	BLAST
low complexity region	813	837	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Photon absorption triggers a signaling cascade in rod photoreceptors that activates cGMP phosphodiesterase (PDE), resulting in the rapid hydrolysis of cGMP, closure of cGMP-gated cation channels, and hyperpolarization of the cell. PDE is a peripheral membrane heterotrimeric enzyme made up of alpha, beta, and gamma subunits. This gene encodes the beta subunit. Mutations in this gene result in retinitis pigmentosa and autosomal dominant congenital stationary night blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for the rd1 mutation have severe retinal degeneration and vision loss. Rod cells are lost by 35 days of age; cone cells degenerate slower and some light sensitivity persists. Other allelic mutations produce similar or milder phenotypes. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(1) Targeted, other(1) Spontaneous(2) Chemically induced(9)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	A	G	6: 129,331,011	W32R	possibly damaging	Het
Abcb11	GTTGATCCATACA	G	2: 69,323,873		probably benign	Het
Ano6	C	A	15: 95,972,589	T875K	probably damaging	Het
Armc8	G	A	9: 99,536,219	T94I	probably damaging	Het
Ash1l	C	T	3: 89,070,317	R2685*	probably null	Het
Bri3bp	A	T	5: 125,454,331	N114Y	probably damaging	Het
Camkk2	G	T	5: 122,764,034	Q71K	probably benign	Het
Cc2d2b	T	C	19: 40,777,292	F49S		Het
Cdh10	A	G	15: 18,964,249	T166A	probably benign	Het
Chd8	A	G	14: 52,227,506	F633L	probably benign	Het
Cntn5	G	A	9: 9,748,445	T477I	probably damaging	Het
Cyp2c37	T	A	19: 39,993,758	Y68N	probably damaging	Het
Dnah2	A	T	11: 69,517,685	L53*	probably null	Het
Dnajc11	A	G	4: 151,950,452	D44G	probably damaging	Het
Elovl3	T	C	19: 46,134,729	F248S	probably damaging	Het
Etfdh	A	G	3: 79,609,816	L422P	probably benign	Het
Fam184a	C	A	10: 53,633,706	E126*	probably null	Het
Fgd4	A	G	16: 16,469,773	Y355H	probably damaging	Het
Fgfr2	A	G	7: 130,219,093	M237T	probably damaging	Het
Gdap1	A	T	1: 17,159,953	K203N	probably benign	Het
Glis1	A	G	4: 107,627,526	D594G	possibly damaging	Het
Gm4787	T	A	12: 81,377,905	H493L	probably benign	Het
Gpatch3	G	T	4: 133,582,997	V418L	probably damaging	Het
Greb1	T	C	12: 16,716,669	N376S	probably damaging	Het
Hspg2	A	G	4: 137,550,932	Q3010R	probably benign	Het
Ice2	T	A	9: 69,410,785	F223I	possibly damaging	Het
March11	A	G	15: 26,409,237	T341A	probably damaging	Het
Mllt10	A	G	2: 18,206,084	K770E	probably damaging	Het
Mug1	A	G	6: 121,861,169	T453A	probably benign	Het
Myh15	C	T	16: 49,155,646	T1359I	probably benign	Het
Nbn	A	G	4: 15,958,080	K3E	probably damaging	Het
Nlrp4a	T	C	7: 26,464,146	F913L	probably benign	Het
Nlrx1	G	T	9: 44,264,789	A48D	probably damaging	Het
Noc3l	C	G	19: 38,795,003	G643A	possibly damaging	Het
Olfr1307	T	C	2: 111,944,530	R309G	probably benign	Het
Olfr895	T	A	9: 38,269,048	N170K	probably benign	Het
Phactr1	A	G	13: 43,077,729	I247V	unknown	Het
Pid1	G	T	1: 84,116,024	Q48K	probably benign	Het
Ppfia2	A	G	10: 106,863,372	N794S	probably benign	Het
Ppox	G	A	1: 171,279,972	S123L	possibly damaging	Het
Ptprd	A	C	4: 76,095,535	D778E	probably benign	Het
Rgs13	A	G	1: 144,140,862	Y48H	probably damaging	Het
Rgs17	T	A	10: 5,833,078	M190L	probably benign	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Scaf8	C	T	17: 3,197,207	P935L	probably damaging	Het
Slc17a2	A	G	13: 23,812,665	H51R	probably benign	Het
Slc22a6	T	C	19: 8,623,889	I435T	probably benign	Het
Snx4	T	C	16: 33,291,829	L378P	probably damaging	Het
Spns1	A	G	7: 126,374,054	L155P	probably damaging	Het
St8sia4	T	C	1: 95,653,595	T141A	possibly damaging	Het
Syt10	A	T	15: 89,782,617	S510R	probably damaging	Het
Tmprss11d	A	T	5: 86,309,490	F241L	probably benign	Het
Tnfrsf21	A	T	17: 43,037,925	T143S	probably benign	Het
Trim72	A	G	7: 128,010,319	N431S	probably benign	Het
Usp43	A	G	11: 67,855,789	S1031P	probably damaging	Het
Wdr75	A	G	1: 45,819,639	Y656C	probably benign	Het
Zfp28	T	C	7: 6,393,786	C407R	probably damaging	Het
Zfp804b	C	T	5: 6,771,866	R399Q	possibly damaging	Het
Zfp949	T	A	9: 88,569,270	C298S	probably damaging	Het

Other mutations in Pde6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00534:Pde6b	APN	5	108426571	splice site	probably benign
IGL01071:Pde6b	APN	5	108419715	nonsense	probably null
IGL01335:Pde6b	APN	5	108423513	missense	probably benign	0.03
IGL01611:Pde6b	APN	5	108403396	missense	possibly damaging	0.90
IGL01881:Pde6b	APN	5	108421500	missense	probably benign	0.01
IGL01941:Pde6b	APN	5	108423036	missense	probably benign	0.11
IGL02616:Pde6b	APN	5	108431541	missense	probably benign	0.05
IGL02657:Pde6b	APN	5	108420276	splice site	probably benign
IGL03217:Pde6b	APN	5	108419566	missense	probably damaging	1.00
Bemr28	UTSW	5		unclassified
D4043:Pde6b	UTSW	5	108425356	nonsense	probably null
N/A:Pde6b	UTSW	5	108429103	unclassified	probably benign
PIT4362001:Pde6b	UTSW	5	108423585	critical splice donor site	probably null
PIT4581001:Pde6b	UTSW	5	108428508	missense	probably benign	0.01
R0940:Pde6b	UTSW	5	108420337	missense	possibly damaging	0.95
R0963:Pde6b	UTSW	5	108430668	missense	probably benign
R1738:Pde6b	UTSW	5	108430559	nonsense	probably null
R1753:Pde6b	UTSW	5	108388691	nonsense	probably null
R1801:Pde6b	UTSW	5	108427847	missense	possibly damaging	0.51
R1913:Pde6b	UTSW	5	108427190	missense	probably benign	0.05
R2131:Pde6b	UTSW	5	108428203	missense	probably damaging	1.00
R2282:Pde6b	UTSW	5	108423586	splice site	probably null
R3713:Pde6b	UTSW	5	108423062	missense	probably damaging	1.00
R4385:Pde6b	UTSW	5	108427642	missense	probably benign	0.08
R4562:Pde6b	UTSW	5	108403368	missense	probably benign	0.23
R4582:Pde6b	UTSW	5	108425231	critical splice acceptor site	probably null
R4939:Pde6b	UTSW	5	108421497	missense	probably benign	0.01
R4950:Pde6b	UTSW	5	108430703	missense	probably benign	0.16
R4972:Pde6b	UTSW	5	108425264	missense	probably benign	0.00
R4983:Pde6b	UTSW	5	108425330	missense	probably benign	0.21
R5056:Pde6b	UTSW	5	108423491	nonsense	probably null
R5514:Pde6b	UTSW	5	108423451	missense	probably benign	0.06
R5528:Pde6b	UTSW	5	108423558	missense	probably benign	0.04
R5937:Pde6b	UTSW	5	108424327	missense	probably benign	0.00
R6556:Pde6b	UTSW	5	108421501	missense	possibly damaging	0.56
R6826:Pde6b	UTSW	5	108430592	nonsense	probably null
R6884:Pde6b	UTSW	5	108388708	missense	probably damaging	0.99
R7213:Pde6b	UTSW	5	108404090	missense	probably damaging	1.00
R7444:Pde6b	UTSW	5	108427142	nonsense	probably null
R7690:Pde6b	UTSW	5	108419518	missense	probably damaging	1.00
R7909:Pde6b	UTSW	5	108403422	missense	probably benign	0.01
R8049:Pde6b	UTSW	5	108425252	missense	probably benign	0.04
R8087:Pde6b	UTSW	5	108388462	missense	probably benign	0.00
R8698:Pde6b	UTSW	5	108428239	missense	possibly damaging	0.87
R8822:Pde6b	UTSW	5	108403462	missense	probably benign	0.00
R8985:Pde6b	UTSW	5	108430637	missense	probably benign	0.02
R9016:Pde6b	UTSW	5	108388726	missense	possibly damaging	0.88
R9292:Pde6b	UTSW	5	108388885	missense	probably benign	0.00
R9323:Pde6b	UTSW	5	108403432	missense	probably damaging	1.00
R9414:Pde6b	UTSW	5	108419726	missense	possibly damaging	0.82
R9486:Pde6b	UTSW	5	108403375	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AACGGTATTCAGTGGGCCTC -3'
(R):5'- AATTCATGTGGAAGCATGTCAC -3'

Sequencing Primer
(F):5'- CTCCTGGACATGACCAAGGAG -3'
(R):5'- GTCACAATATATGTAGGAGCTCTGGC -3'

Posted On

2020-09-15