Incidental Mutation 'R7937:Nlrp4a'
ID 648806
Institutional Source Beutler Lab
Gene Symbol Nlrp4a
Ensembl Gene ENSMUSG00000040601
Gene Name NLR family, pyrin domain containing 4A
Synonyms Nalp-eta, E330028A19Rik, Nalp4a
MMRRC Submission 045983-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R7937 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 26134538-26175100 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26163571 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 913 (F913L)
Ref Sequence ENSEMBL: ENSMUSP00000066841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068767] [ENSMUST00000119386] [ENSMUST00000146907]
AlphaFold Q8BU40
Predicted Effect probably benign
Transcript: ENSMUST00000068767
AA Change: F913L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000066841
Gene: ENSMUSG00000040601
AA Change: F913L

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 4.9e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119386
AA Change: F913L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112441
Gene: ENSMUSG00000040601
AA Change: F913L

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 1.3e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146907
AA Change: F913L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 GTTGATCCATACA G 2: 69,154,217 (GRCm39) probably benign Het
Ano6 C A 15: 95,870,470 (GRCm39) T875K probably damaging Het
Armc8 G A 9: 99,418,272 (GRCm39) T94I probably damaging Het
Ash1l C T 3: 88,977,624 (GRCm39) R2685* probably null Het
Bri3bp A T 5: 125,531,395 (GRCm39) N114Y probably damaging Het
Camkk2 G T 5: 122,902,097 (GRCm39) Q71K probably benign Het
Cc2d2b T C 19: 40,765,736 (GRCm39) F49S Het
Cdh10 A G 15: 18,964,335 (GRCm39) T166A probably benign Het
Chd8 A G 14: 52,464,963 (GRCm39) F633L probably benign Het
Clec2m A G 6: 129,307,974 (GRCm39) W32R possibly damaging Het
Cntn5 G A 9: 9,748,450 (GRCm39) T477I probably damaging Het
Cyp2c37 T A 19: 39,982,202 (GRCm39) Y68N probably damaging Het
Dnah2 A T 11: 69,408,511 (GRCm39) L53* probably null Het
Dnajc11 A G 4: 152,034,909 (GRCm39) D44G probably damaging Het
Elovl3 T C 19: 46,123,168 (GRCm39) F248S probably damaging Het
Etfdh A G 3: 79,517,123 (GRCm39) L422P probably benign Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fgd4 A G 16: 16,287,637 (GRCm39) Y355H probably damaging Het
Fgfr2 A G 7: 129,820,823 (GRCm39) M237T probably damaging Het
Gdap1 A T 1: 17,230,177 (GRCm39) K203N probably benign Het
Glis1 A G 4: 107,484,723 (GRCm39) D594G possibly damaging Het
Gm4787 T A 12: 81,424,679 (GRCm39) H493L probably benign Het
Gpatch3 G T 4: 133,310,308 (GRCm39) V418L probably damaging Het
Greb1 T C 12: 16,766,670 (GRCm39) N376S probably damaging Het
Hspg2 A G 4: 137,278,243 (GRCm39) Q3010R probably benign Het
Ice2 T A 9: 69,318,067 (GRCm39) F223I possibly damaging Het
Marchf11 A G 15: 26,409,323 (GRCm39) T341A probably damaging Het
Mllt10 A G 2: 18,210,895 (GRCm39) K770E probably damaging Het
Mug1 A G 6: 121,838,128 (GRCm39) T453A probably benign Het
Myh15 C T 16: 48,976,009 (GRCm39) T1359I probably benign Het
Nbn A G 4: 15,958,080 (GRCm39) K3E probably damaging Het
Nlrx1 G T 9: 44,176,086 (GRCm39) A48D probably damaging Het
Noc3l C G 19: 38,783,447 (GRCm39) G643A possibly damaging Het
Or4f14b T C 2: 111,774,875 (GRCm39) R309G probably benign Het
Or8c17 T A 9: 38,180,344 (GRCm39) N170K probably benign Het
Pde6b G T 5: 108,567,639 (GRCm39) probably null Het
Phactr1 A G 13: 43,231,205 (GRCm39) I247V unknown Het
Pid1 G T 1: 84,093,745 (GRCm39) Q48K probably benign Het
Ppfia2 A G 10: 106,699,233 (GRCm39) N794S probably benign Het
Ppox G A 1: 171,107,546 (GRCm39) S123L possibly damaging Het
Ptprd A C 4: 76,013,772 (GRCm39) D778E probably benign Het
Rgs13 A G 1: 144,016,600 (GRCm39) Y48H probably damaging Het
Rgs17 T A 10: 5,783,078 (GRCm39) M190L probably benign Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Scaf8 C T 17: 3,247,482 (GRCm39) P935L probably damaging Het
Slc22a6 T C 19: 8,601,253 (GRCm39) I435T probably benign Het
Slc34a1 A G 13: 23,996,648 (GRCm39) H51R probably benign Het
Snx4 T C 16: 33,112,199 (GRCm39) L378P probably damaging Het
Spns1 A G 7: 125,973,226 (GRCm39) L155P probably damaging Het
St8sia4 T C 1: 95,581,320 (GRCm39) T141A possibly damaging Het
Syt10 A T 15: 89,666,820 (GRCm39) S510R probably damaging Het
Tmprss11d A T 5: 86,457,349 (GRCm39) F241L probably benign Het
Tnfrsf21 A T 17: 43,348,816 (GRCm39) T143S probably benign Het
Trim72 A G 7: 127,609,491 (GRCm39) N431S probably benign Het
Usp43 A G 11: 67,746,615 (GRCm39) S1031P probably damaging Het
Wdr75 A G 1: 45,858,799 (GRCm39) Y656C probably benign Het
Zfp28 T C 7: 6,396,785 (GRCm39) C407R probably damaging Het
Zfp804b C T 5: 6,821,866 (GRCm39) R399Q possibly damaging Het
Zfp949 T A 9: 88,451,323 (GRCm39) C298S probably damaging Het
Other mutations in Nlrp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nlrp4a APN 7 26,149,410 (GRCm39) missense possibly damaging 0.51
IGL00972:Nlrp4a APN 7 26,156,473 (GRCm39) missense probably benign
IGL01081:Nlrp4a APN 7 26,149,254 (GRCm39) missense probably benign 0.06
IGL01788:Nlrp4a APN 7 26,153,492 (GRCm39) missense probably benign 0.17
IGL02001:Nlrp4a APN 7 26,149,394 (GRCm39) missense probably benign 0.01
IGL02070:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02175:Nlrp4a APN 7 26,174,522 (GRCm39) missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02193:Nlrp4a APN 7 26,159,117 (GRCm39) missense probably damaging 1.00
IGL02197:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02200:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02202:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02207:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02237:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02240:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02658:Nlrp4a APN 7 26,149,138 (GRCm39) missense probably benign 0.43
IGL02743:Nlrp4a APN 7 26,159,240 (GRCm39) splice site probably benign
IGL02960:Nlrp4a APN 7 26,149,155 (GRCm39) missense probably benign 0.05
IGL03064:Nlrp4a APN 7 26,148,934 (GRCm39) missense probably benign 0.23
IGL03276:Nlrp4a APN 7 26,163,615 (GRCm39) missense probably damaging 1.00
BB002:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
BB012:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
D3080:Nlrp4a UTSW 7 26,143,766 (GRCm39) missense probably benign 0.22
P0019:Nlrp4a UTSW 7 26,149,062 (GRCm39) missense probably damaging 1.00
R0020:Nlrp4a UTSW 7 26,149,797 (GRCm39) missense probably damaging 1.00
R0240:Nlrp4a UTSW 7 26,161,941 (GRCm39) missense probably benign 0.00
R0240:Nlrp4a UTSW 7 26,161,941 (GRCm39) missense probably benign 0.00
R0372:Nlrp4a UTSW 7 26,148,657 (GRCm39) splice site probably benign
R0466:Nlrp4a UTSW 7 26,162,045 (GRCm39) splice site probably benign
R0544:Nlrp4a UTSW 7 26,156,555 (GRCm39) missense probably benign 0.00
R1006:Nlrp4a UTSW 7 26,152,892 (GRCm39) missense probably benign 0.30
R1072:Nlrp4a UTSW 7 26,143,860 (GRCm39) missense probably damaging 1.00
R1432:Nlrp4a UTSW 7 26,163,622 (GRCm39) frame shift probably null
R1655:Nlrp4a UTSW 7 26,149,076 (GRCm39) missense possibly damaging 0.56
R1696:Nlrp4a UTSW 7 26,149,959 (GRCm39) missense probably damaging 1.00
R2041:Nlrp4a UTSW 7 26,149,611 (GRCm39) missense probably damaging 0.97
R2091:Nlrp4a UTSW 7 26,149,578 (GRCm39) missense probably damaging 1.00
R2163:Nlrp4a UTSW 7 26,152,822 (GRCm39) missense probably benign 0.00
R2174:Nlrp4a UTSW 7 26,148,849 (GRCm39) missense probably damaging 1.00
R2319:Nlrp4a UTSW 7 26,149,319 (GRCm39) missense probably benign 0.10
R2358:Nlrp4a UTSW 7 26,163,623 (GRCm39) missense probably benign 0.03
R2680:Nlrp4a UTSW 7 26,148,655 (GRCm39) splice site probably null
R3812:Nlrp4a UTSW 7 26,149,118 (GRCm39) missense probably benign
R4114:Nlrp4a UTSW 7 26,149,365 (GRCm39) missense probably damaging 1.00
R4664:Nlrp4a UTSW 7 26,148,943 (GRCm39) nonsense probably null
R4676:Nlrp4a UTSW 7 26,149,654 (GRCm39) missense probably damaging 1.00
R4708:Nlrp4a UTSW 7 26,163,533 (GRCm39) missense probably benign 0.00
R4728:Nlrp4a UTSW 7 26,174,515 (GRCm39) missense probably benign 0.24
R4815:Nlrp4a UTSW 7 26,150,233 (GRCm39) missense probably benign 0.00
R4831:Nlrp4a UTSW 7 26,149,844 (GRCm39) missense possibly damaging 0.92
R5007:Nlrp4a UTSW 7 26,161,905 (GRCm39) missense probably damaging 0.99
R5253:Nlrp4a UTSW 7 26,149,917 (GRCm39) missense probably benign 0.00
R5262:Nlrp4a UTSW 7 26,159,236 (GRCm39) critical splice donor site probably null
R5441:Nlrp4a UTSW 7 26,153,578 (GRCm39) missense probably damaging 1.00
R5639:Nlrp4a UTSW 7 26,156,455 (GRCm39) missense probably benign 0.02
R5641:Nlrp4a UTSW 7 26,149,589 (GRCm39) missense probably damaging 1.00
R5771:Nlrp4a UTSW 7 26,152,814 (GRCm39) missense probably damaging 1.00
R6312:Nlrp4a UTSW 7 26,148,821 (GRCm39) missense probably benign 0.11
R7131:Nlrp4a UTSW 7 26,149,258 (GRCm39) missense probably benign 0.21
R7149:Nlrp4a UTSW 7 26,149,863 (GRCm39) missense probably benign 0.00
R7348:Nlrp4a UTSW 7 26,143,698 (GRCm39) missense probably damaging 1.00
R7384:Nlrp4a UTSW 7 26,148,963 (GRCm39) missense not run
R7548:Nlrp4a UTSW 7 26,149,604 (GRCm39) missense probably damaging 1.00
R7566:Nlrp4a UTSW 7 26,148,670 (GRCm39) critical splice acceptor site probably null
R7646:Nlrp4a UTSW 7 26,148,987 (GRCm39) missense probably damaging 0.96
R7692:Nlrp4a UTSW 7 26,148,690 (GRCm39) missense probably benign 0.01
R7902:Nlrp4a UTSW 7 26,149,482 (GRCm39) missense possibly damaging 0.65
R7925:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
R7992:Nlrp4a UTSW 7 26,150,070 (GRCm39) missense possibly damaging 0.51
R8205:Nlrp4a UTSW 7 26,150,219 (GRCm39) missense probably benign
R8477:Nlrp4a UTSW 7 26,159,219 (GRCm39) missense probably benign
R8704:Nlrp4a UTSW 7 26,156,563 (GRCm39) missense probably benign 0.02
R8791:Nlrp4a UTSW 7 26,143,561 (GRCm39) splice site probably benign
R9220:Nlrp4a UTSW 7 26,149,523 (GRCm39) missense probably damaging 0.97
R9332:Nlrp4a UTSW 7 26,159,077 (GRCm39) missense probably damaging 0.99
T0975:Nlrp4a UTSW 7 26,149,062 (GRCm39) missense probably damaging 1.00
X0022:Nlrp4a UTSW 7 26,143,767 (GRCm39) missense probably damaging 0.99
Z1088:Nlrp4a UTSW 7 26,153,588 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGACACTGGGCTTTTAAGAG -3'
(R):5'- TCAAGCCCTCTATGGACTGAAC -3'

Sequencing Primer
(F):5'- GCTTTTAAGAGCCTGTCCTCAAAGG -3'
(R):5'- CCCTCTATGGACTGAACTCATATTTC -3'
Posted On 2020-09-15