Incidental Mutation 'R7937:Armc8'
ID648815
Institutional Source Beutler Lab
Gene Symbol Armc8
Ensembl Gene ENSMUSG00000032468
Gene Namearmadillo repeat containing 8
Synonyms1200015K23Rik, HSPC056, Gid5
MMRRC Submission
Accession Numbers

Genbank: NM_028768; MGI: 1921375

Is this an essential gene? Possibly essential (E-score: 0.608) question?
Stock #R7937 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location99478372-99568899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99536219 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 94 (T94I)
Ref Sequence ENSEMBL: ENSMUSP00000035043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035043] [ENSMUST00000185524] [ENSMUST00000186049]
Predicted Effect probably damaging
Transcript: ENSMUST00000035043
AA Change: T94I

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035043
Gene: ENSMUSG00000032468
AA Change: T94I

DomainStartEndE-ValueType
ARM 50 92 1.75e0 SMART
ARM 94 134 5.34e0 SMART
ARM 177 217 2.04e1 SMART
ARM 372 413 3.58e1 SMART
Blast:ARM 414 455 7e-17 BLAST
ARM 457 497 3.81e-1 SMART
ARM 500 540 5.43e1 SMART
Blast:ARM 542 585 1e-20 BLAST
Blast:ARM 633 673 1e-16 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000185524
AA Change: T94I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139973
Gene: ENSMUSG00000032468
AA Change: T94I

DomainStartEndE-ValueType
ARM 50 92 1.75e0 SMART
ARM 94 134 5.34e0 SMART
Blast:ARM 138 176 1e-5 BLAST
ARM 177 217 2.04e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186049
AA Change: T52I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140426
Gene: ENSMUSG00000032468
AA Change: T52I

DomainStartEndE-ValueType
ARM 8 50 8.5e-3 SMART
ARM 52 92 2.6e-2 SMART
Blast:ARM 96 134 7e-6 BLAST
ARM 135 175 9.8e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,331,011 W32R possibly damaging Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Ano6 C A 15: 95,972,589 T875K probably damaging Het
Ash1l C T 3: 89,070,317 R2685* probably null Het
Bri3bp A T 5: 125,454,331 N114Y probably damaging Het
Camkk2 G T 5: 122,764,034 Q71K probably benign Het
Cc2d2b T C 19: 40,777,292 F49S Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Chd8 A G 14: 52,227,506 F633L probably benign Het
Cntn5 G A 9: 9,748,445 T477I probably damaging Het
Cyp2c37 T A 19: 39,993,758 Y68N probably damaging Het
Dnah2 A T 11: 69,517,685 L53* probably null Het
Dnajc11 A G 4: 151,950,452 D44G probably damaging Het
Elovl3 T C 19: 46,134,729 F248S probably damaging Het
Etfdh A G 3: 79,609,816 L422P probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fgd4 A G 16: 16,469,773 Y355H probably damaging Het
Fgfr2 A G 7: 130,219,093 M237T probably damaging Het
Gdap1 A T 1: 17,159,953 K203N probably benign Het
Glis1 A G 4: 107,627,526 D594G possibly damaging Het
Gm4787 T A 12: 81,377,905 H493L probably benign Het
Gpatch3 G T 4: 133,582,997 V418L probably damaging Het
Greb1 T C 12: 16,716,669 N376S probably damaging Het
Hspg2 A G 4: 137,550,932 Q3010R probably benign Het
Ice2 T A 9: 69,410,785 F223I possibly damaging Het
March11 A G 15: 26,409,237 T341A probably damaging Het
Mllt10 A G 2: 18,206,084 K770E probably damaging Het
Mug1 A G 6: 121,861,169 T453A probably benign Het
Myh15 C T 16: 49,155,646 T1359I probably benign Het
Nbn A G 4: 15,958,080 K3E probably damaging Het
Nlrp4a T C 7: 26,464,146 F913L probably benign Het
Nlrx1 G T 9: 44,264,789 A48D probably damaging Het
Noc3l C G 19: 38,795,003 G643A possibly damaging Het
Olfr1307 T C 2: 111,944,530 R309G probably benign Het
Olfr895 T A 9: 38,269,048 N170K probably benign Het
Pde6b G T 5: 108,419,773 probably null Het
Phactr1 A G 13: 43,077,729 I247V unknown Het
Pid1 G T 1: 84,116,024 Q48K probably benign Het
Ppfia2 A G 10: 106,863,372 N794S probably benign Het
Ppox G A 1: 171,279,972 S123L possibly damaging Het
Ptprd A C 4: 76,095,535 D778E probably benign Het
Rgs13 A G 1: 144,140,862 Y48H probably damaging Het
Rgs17 T A 10: 5,833,078 M190L probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Scaf8 C T 17: 3,197,207 P935L probably damaging Het
Slc17a2 A G 13: 23,812,665 H51R probably benign Het
Slc22a6 T C 19: 8,623,889 I435T probably benign Het
Snx4 T C 16: 33,291,829 L378P probably damaging Het
Spns1 A G 7: 126,374,054 L155P probably damaging Het
St8sia4 T C 1: 95,653,595 T141A possibly damaging Het
Syt10 A T 15: 89,782,617 S510R probably damaging Het
Tmprss11d A T 5: 86,309,490 F241L probably benign Het
Tnfrsf21 A T 17: 43,037,925 T143S probably benign Het
Trim72 A G 7: 128,010,319 N431S probably benign Het
Usp43 A G 11: 67,855,789 S1031P probably damaging Het
Wdr75 A G 1: 45,819,639 Y656C probably benign Het
Zfp28 T C 7: 6,393,786 C407R probably damaging Het
Zfp804b C T 5: 6,771,866 R399Q possibly damaging Het
Zfp949 T A 9: 88,569,270 C298S probably damaging Het
Other mutations in Armc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Armc8 APN 9 99505734 critical splice acceptor site probably null
IGL00951:Armc8 APN 9 99505704 missense probably benign 0.00
IGL01776:Armc8 APN 9 99526883 splice site probably benign
IGL02215:Armc8 APN 9 99483978 missense possibly damaging 0.92
IGL02244:Armc8 APN 9 99483174 missense probably benign 0.10
IGL02610:Armc8 APN 9 99527069 splice site probably benign
IGL02612:Armc8 APN 9 99527069 splice site probably benign
IGL02615:Armc8 APN 9 99527069 splice site probably benign
IGL02619:Armc8 APN 9 99527069 splice site probably benign
IGL02621:Armc8 APN 9 99527069 splice site probably benign
IGL02622:Armc8 APN 9 99527069 splice site probably benign
IGL02623:Armc8 APN 9 99527069 splice site probably benign
IGL02624:Armc8 APN 9 99527069 splice site probably benign
Scrambler UTSW 9 99496149 critical splice donor site probably null
warthog UTSW 9 99520485 missense probably benign 0.02
D4043:Armc8 UTSW 9 99483976 missense probably benign 0.13
R0321:Armc8 UTSW 9 99533177 missense probably damaging 0.99
R0498:Armc8 UTSW 9 99497292 missense probably damaging 1.00
R0646:Armc8 UTSW 9 99505688 missense probably damaging 1.00
R0658:Armc8 UTSW 9 99536158 splice site probably benign
R1061:Armc8 UTSW 9 99537731 missense probably damaging 1.00
R1406:Armc8 UTSW 9 99523248 missense probably benign 0.37
R1406:Armc8 UTSW 9 99523248 missense probably benign 0.37
R1429:Armc8 UTSW 9 99536207 missense possibly damaging 0.67
R1432:Armc8 UTSW 9 99523132 splice site probably benign
R1538:Armc8 UTSW 9 99505290 missense probably damaging 0.96
R1606:Armc8 UTSW 9 99537729 missense probably damaging 0.98
R1817:Armc8 UTSW 9 99536259 missense possibly damaging 0.67
R1866:Armc8 UTSW 9 99536280 missense probably benign
R2015:Armc8 UTSW 9 99483105 nonsense probably null
R2143:Armc8 UTSW 9 99505308 missense probably damaging 0.99
R2251:Armc8 UTSW 9 99502600 critical splice acceptor site probably null
R2842:Armc8 UTSW 9 99505681 missense probably benign
R3010:Armc8 UTSW 9 99487913 missense probably benign 0.06
R3709:Armc8 UTSW 9 99520497 missense probably damaging 1.00
R4440:Armc8 UTSW 9 99484034 missense probably benign 0.37
R4865:Armc8 UTSW 9 99526889 critical splice donor site probably null
R5492:Armc8 UTSW 9 99527131 nonsense probably null
R5606:Armc8 UTSW 9 99536262 missense probably benign 0.23
R5639:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5693:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5694:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5698:Armc8 UTSW 9 99535820 missense probably benign 0.12
R5700:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5701:Armc8 UTSW 9 99496149 critical splice donor site probably null
R5735:Armc8 UTSW 9 99497394 critical splice acceptor site probably null
R6314:Armc8 UTSW 9 99535884 missense probably benign 0.28
R7034:Armc8 UTSW 9 99483965 critical splice donor site probably null
R7036:Armc8 UTSW 9 99483965 critical splice donor site probably null
R7393:Armc8 UTSW 9 99483999 missense possibly damaging 0.47
R7395:Armc8 UTSW 9 99533132 missense probably damaging 0.99
R8130:Armc8 UTSW 9 99551547 missense probably benign 0.02
R8373:Armc8 UTSW 9 99527099 missense probably benign 0.02
R8734:Armc8 UTSW 9 99520485 missense probably benign 0.02
Z1177:Armc8 UTSW 9 99497386 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCCTAGTAAGATAAACTGCATGTG -3'
(R):5'- GGCTGTATTTCCCACACTGC -3'

Sequencing Primer
(F):5'- TCACTCTGTAGACCAAGCTGG -3'
(R):5'- CCTCAAGTACAGAGCTGAA -3'
Posted On2020-09-15