Incidental Mutation 'R7937:Greb1'
ID 648821
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Name gene regulated by estrogen in breast cancer protein
Synonyms 5730583K22Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7937 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 16670615-16800886 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16716669 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 376 (N376S)
Ref Sequence ENSEMBL: ENSMUSP00000044454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
AlphaFold Q3UHK3
Predicted Effect probably damaging
Transcript: ENSMUST00000048064
AA Change: N376S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: N376S

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159120
AA Change: N376S

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: N376S

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160627
SMART Domains Protein: ENSMUSP00000124922
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
Pfam:GREB1 1 122 1.8e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162112
AA Change: N376S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: N376S

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,331,011 W32R possibly damaging Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Ano6 C A 15: 95,972,589 T875K probably damaging Het
Armc8 G A 9: 99,536,219 T94I probably damaging Het
Ash1l C T 3: 89,070,317 R2685* probably null Het
Bri3bp A T 5: 125,454,331 N114Y probably damaging Het
Camkk2 G T 5: 122,764,034 Q71K probably benign Het
Cc2d2b T C 19: 40,777,292 F49S Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Chd8 A G 14: 52,227,506 F633L probably benign Het
Cntn5 G A 9: 9,748,445 T477I probably damaging Het
Cyp2c37 T A 19: 39,993,758 Y68N probably damaging Het
Dnah2 A T 11: 69,517,685 L53* probably null Het
Dnajc11 A G 4: 151,950,452 D44G probably damaging Het
Elovl3 T C 19: 46,134,729 F248S probably damaging Het
Etfdh A G 3: 79,609,816 L422P probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fgd4 A G 16: 16,469,773 Y355H probably damaging Het
Fgfr2 A G 7: 130,219,093 M237T probably damaging Het
Gdap1 A T 1: 17,159,953 K203N probably benign Het
Glis1 A G 4: 107,627,526 D594G possibly damaging Het
Gm4787 T A 12: 81,377,905 H493L probably benign Het
Gpatch3 G T 4: 133,582,997 V418L probably damaging Het
Hspg2 A G 4: 137,550,932 Q3010R probably benign Het
Ice2 T A 9: 69,410,785 F223I possibly damaging Het
March11 A G 15: 26,409,237 T341A probably damaging Het
Mllt10 A G 2: 18,206,084 K770E probably damaging Het
Mug1 A G 6: 121,861,169 T453A probably benign Het
Myh15 C T 16: 49,155,646 T1359I probably benign Het
Nbn A G 4: 15,958,080 K3E probably damaging Het
Nlrp4a T C 7: 26,464,146 F913L probably benign Het
Nlrx1 G T 9: 44,264,789 A48D probably damaging Het
Noc3l C G 19: 38,795,003 G643A possibly damaging Het
Olfr1307 T C 2: 111,944,530 R309G probably benign Het
Olfr895 T A 9: 38,269,048 N170K probably benign Het
Pde6b G T 5: 108,419,773 probably null Het
Phactr1 A G 13: 43,077,729 I247V unknown Het
Pid1 G T 1: 84,116,024 Q48K probably benign Het
Ppfia2 A G 10: 106,863,372 N794S probably benign Het
Ppox G A 1: 171,279,972 S123L possibly damaging Het
Ptprd A C 4: 76,095,535 D778E probably benign Het
Rgs13 A G 1: 144,140,862 Y48H probably damaging Het
Rgs17 T A 10: 5,833,078 M190L probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Scaf8 C T 17: 3,197,207 P935L probably damaging Het
Slc17a2 A G 13: 23,812,665 H51R probably benign Het
Slc22a6 T C 19: 8,623,889 I435T probably benign Het
Snx4 T C 16: 33,291,829 L378P probably damaging Het
Spns1 A G 7: 126,374,054 L155P probably damaging Het
St8sia4 T C 1: 95,653,595 T141A possibly damaging Het
Syt10 A T 15: 89,782,617 S510R probably damaging Het
Tmprss11d A T 5: 86,309,490 F241L probably benign Het
Tnfrsf21 A T 17: 43,037,925 T143S probably benign Het
Trim72 A G 7: 128,010,319 N431S probably benign Het
Usp43 A G 11: 67,855,789 S1031P probably damaging Het
Wdr75 A G 1: 45,819,639 Y656C probably benign Het
Zfp28 T C 7: 6,393,786 C407R probably damaging Het
Zfp804b C T 5: 6,771,866 R399Q possibly damaging Het
Zfp949 T A 9: 88,569,270 C298S probably damaging Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16711961 missense probably damaging 1.00
IGL01316:Greb1 APN 12 16698586 missense probably benign 0.04
IGL01464:Greb1 APN 12 16714826 missense probably damaging 0.99
IGL01474:Greb1 APN 12 16684501 missense probably benign
IGL01522:Greb1 APN 12 16701201 missense probably damaging 1.00
IGL01824:Greb1 APN 12 16711716 nonsense probably null
IGL01837:Greb1 APN 12 16684451 missense probably benign 0.19
IGL01991:Greb1 APN 12 16699681 missense probably damaging 1.00
IGL01996:Greb1 APN 12 16690845 missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16706232 missense probably damaging 1.00
IGL02267:Greb1 APN 12 16717208 missense probably benign 0.00
IGL02512:Greb1 APN 12 16692712 missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16706295 splice site probably benign
IGL02613:Greb1 APN 12 16739888 critical splice donor site probably null
IGL02648:Greb1 APN 12 16708682 missense probably damaging 1.00
IGL02679:Greb1 APN 12 16708723 missense probably damaging 1.00
begraben UTSW 12 16684373 missense possibly damaging 0.51
Eared UTSW 12 16673863 missense probably damaging 1.00
Humpback UTSW 12 16701171 missense probably damaging 1.00
pied_billed UTSW 12 16724857 missense possibly damaging 0.79
rednecked UTSW 12 16682152 missense probably damaging 0.99
G1patch:Greb1 UTSW 12 16688567 missense probably damaging 1.00
IGL03048:Greb1 UTSW 12 16733331 missense probably damaging 1.00
R0083:Greb1 UTSW 12 16696451 missense probably benign
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0220:Greb1 UTSW 12 16682286 missense probably damaging 1.00
R0245:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0540:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0547:Greb1 UTSW 12 16723411 missense probably benign
R0563:Greb1 UTSW 12 16680267 missense probably benign 0.23
R0607:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0610:Greb1 UTSW 12 16696442 missense probably benign
R0652:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0659:Greb1 UTSW 12 16680212 missense probably damaging 0.99
R0945:Greb1 UTSW 12 16673802 missense probably benign 0.31
R1055:Greb1 UTSW 12 16682251 missense probably damaging 0.98
R1445:Greb1 UTSW 12 16707851 missense probably damaging 1.00
R1471:Greb1 UTSW 12 16711774 missense probably damaging 0.97
R1503:Greb1 UTSW 12 16724819 nonsense probably null
R1566:Greb1 UTSW 12 16711828 missense possibly damaging 0.94
R1614:Greb1 UTSW 12 16701171 missense probably damaging 1.00
R1623:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R1751:Greb1 UTSW 12 16723438 splice site probably benign
R1778:Greb1 UTSW 12 16690894 missense probably benign
R1842:Greb1 UTSW 12 16696243 missense probably damaging 1.00
R2040:Greb1 UTSW 12 16702650 missense probably damaging 1.00
R2153:Greb1 UTSW 12 16699532 missense probably damaging 1.00
R2178:Greb1 UTSW 12 16696387 missense probably damaging 1.00
R2194:Greb1 UTSW 12 16690908 missense probably benign 0.08
R2248:Greb1 UTSW 12 16680378 missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16714953 missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16724922 missense probably damaging 1.00
R2860:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2861:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2862:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2866:Greb1 UTSW 12 16699550 missense probably damaging 1.00
R2890:Greb1 UTSW 12 16704478 missense probably damaging 1.00
R3056:Greb1 UTSW 12 16688591 missense probably damaging 0.96
R3863:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3864:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3956:Greb1 UTSW 12 16682299 missense probably damaging 1.00
R4493:Greb1 UTSW 12 16698610 missense probably benign 0.14
R4548:Greb1 UTSW 12 16699675 missense probably damaging 1.00
R4683:Greb1 UTSW 12 16711773 missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16696328 missense probably damaging 1.00
R4770:Greb1 UTSW 12 16681356 missense probably benign 0.03
R4838:Greb1 UTSW 12 16684360 critical splice donor site probably null
R4925:Greb1 UTSW 12 16681471 missense probably damaging 1.00
R4982:Greb1 UTSW 12 16724761 missense probably damaging 0.98
R5009:Greb1 UTSW 12 16724857 missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16708022 intron probably benign
R5213:Greb1 UTSW 12 16714790 nonsense probably null
R5310:Greb1 UTSW 12 16716759 missense probably benign 0.09
R5353:Greb1 UTSW 12 16688566 nonsense probably null
R5544:Greb1 UTSW 12 16673796 missense probably damaging 1.00
R5605:Greb1 UTSW 12 16708726 missense probably damaging 0.96
R5708:Greb1 UTSW 12 16673842 missense probably benign 0.11
R5837:Greb1 UTSW 12 16688585 missense probably damaging 1.00
R5890:Greb1 UTSW 12 16733421 missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16717258 missense probably damaging 1.00
R6049:Greb1 UTSW 12 16681394 missense probably damaging 0.99
R6093:Greb1 UTSW 12 16684486 missense probably benign
R6120:Greb1 UTSW 12 16708621 missense probably damaging 0.99
R6175:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R6247:Greb1 UTSW 12 16716675 missense probably damaging 1.00
R6274:Greb1 UTSW 12 16735151 missense probably damaging 0.97
R6376:Greb1 UTSW 12 16699579 missense probably damaging 0.97
R6523:Greb1 UTSW 12 16684373 missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16710383 missense probably benign 0.00
R6602:Greb1 UTSW 12 16709440 missense probably benign 0.44
R6621:Greb1 UTSW 12 16692717 missense probably damaging 1.00
R6645:Greb1 UTSW 12 16698579 missense probably benign 0.07
R6725:Greb1 UTSW 12 16688567 missense probably damaging 1.00
R6750:Greb1 UTSW 12 16688583 missense probably benign 0.05
R6863:Greb1 UTSW 12 16684420 missense probably damaging 1.00
R6914:Greb1 UTSW 12 16707902 missense probably damaging 0.97
R6996:Greb1 UTSW 12 16723354 missense probably benign 0.00
R7083:Greb1 UTSW 12 16723314 missense probably benign
R7147:Greb1 UTSW 12 16733427 missense probably damaging 1.00
R7238:Greb1 UTSW 12 16674672 missense probably damaging 0.99
R7290:Greb1 UTSW 12 16711738 missense probably damaging 1.00
R7358:Greb1 UTSW 12 16724881 missense probably damaging 1.00
R7395:Greb1 UTSW 12 16709430 critical splice donor site probably null
R7526:Greb1 UTSW 12 16716765 missense probably benign 0.00
R7530:Greb1 UTSW 12 16717206 missense probably benign 0.02
R7536:Greb1 UTSW 12 16682185 missense probably damaging 1.00
R7643:Greb1 UTSW 12 16711996 missense probably damaging 0.99
R7732:Greb1 UTSW 12 16673863 missense probably damaging 1.00
R7740:Greb1 UTSW 12 16740121 start gained probably benign
R7747:Greb1 UTSW 12 16674795 missense probably benign 0.01
R7760:Greb1 UTSW 12 16723416 missense probably benign
R8043:Greb1 UTSW 12 16711789 missense probably damaging 1.00
R8259:Greb1 UTSW 12 16724924 nonsense probably null
R8553:Greb1 UTSW 12 16723327 missense probably benign 0.00
R8559:Greb1 UTSW 12 16696435 missense probably damaging 1.00
R8690:Greb1 UTSW 12 16696547 missense probably benign 0.03
R8830:Greb1 UTSW 12 16688519 missense probably benign 0.35
R8911:Greb1 UTSW 12 16690902 missense possibly damaging 0.84
R8963:Greb1 UTSW 12 16724884 missense probably damaging 1.00
R8986:Greb1 UTSW 12 16684456 missense probably damaging 0.99
R9013:Greb1 UTSW 12 16739969 missense probably damaging 1.00
R9279:Greb1 UTSW 12 16682152 missense probably damaging 0.99
R9360:Greb1 UTSW 12 16740036 missense probably damaging 1.00
R9563:Greb1 UTSW 12 16724823 missense probably benign 0.06
R9616:Greb1 UTSW 12 16740037 missense probably damaging 1.00
R9627:Greb1 UTSW 12 16706166 missense probably damaging 1.00
R9731:Greb1 UTSW 12 16688597 missense probably damaging 1.00
R9761:Greb1 UTSW 12 16701274 missense probably benign 0.05
Z1176:Greb1 UTSW 12 16696756 missense probably benign 0.00
Z1177:Greb1 UTSW 12 16702491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGCCGCTTCATTTGATC -3'
(R):5'- CAGGTTTATGAGTATGGAGGCAGC -3'

Sequencing Primer
(F):5'- GATCATTGCCCTGGATAGCATC -3'
(R):5'- AGTATGGAGGCAGCAGTTTTG -3'
Posted On 2020-09-15