Incidental Mutation 'R7937:Slc17a2'
ID648823
Institutional Source Beutler Lab
Gene Symbol Slc17a2
Ensembl Gene ENSMUSG00000036110
Gene Namesolute carrier family 17 (sodium phosphate), member 2
SynonymsNPT3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7937 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location23806993-23825180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23812665 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 51 (H51R)
Ref Sequence ENSEMBL: ENSMUSP00000006786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006786] [ENSMUST00000099697]
Predicted Effect probably benign
Transcript: ENSMUST00000006786
AA Change: H51R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006786
Gene: ENSMUSG00000036110
AA Change: H51R

DomainStartEndE-ValueType
Pfam:MFS_1 19 425 3.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099697
AA Change: H51R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097288
Gene: ENSMUSG00000036110
AA Change: H51R

DomainStartEndE-ValueType
Pfam:MFS_1 19 425 2.9e-45 PFAM
transmembrane domain 443 462 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,331,011 W32R possibly damaging Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Ano6 C A 15: 95,972,589 T875K probably damaging Het
Armc8 G A 9: 99,536,219 T94I probably damaging Het
Ash1l C T 3: 89,070,317 R2685* probably null Het
Bri3bp A T 5: 125,454,331 N114Y probably damaging Het
Camkk2 G T 5: 122,764,034 Q71K probably benign Het
Cc2d2b T C 19: 40,777,292 F49S Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Chd8 A G 14: 52,227,506 F633L probably benign Het
Cntn5 G A 9: 9,748,445 T477I probably damaging Het
Cyp2c37 T A 19: 39,993,758 Y68N probably damaging Het
Dnah2 A T 11: 69,517,685 L53* probably null Het
Dnajc11 A G 4: 151,950,452 D44G probably damaging Het
Elovl3 T C 19: 46,134,729 F248S probably damaging Het
Etfdh A G 3: 79,609,816 L422P probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fgd4 A G 16: 16,469,773 Y355H probably damaging Het
Fgfr2 A G 7: 130,219,093 M237T probably damaging Het
Gdap1 A T 1: 17,159,953 K203N probably benign Het
Glis1 A G 4: 107,627,526 D594G possibly damaging Het
Gm4787 T A 12: 81,377,905 H493L probably benign Het
Gpatch3 G T 4: 133,582,997 V418L probably damaging Het
Greb1 T C 12: 16,716,669 N376S probably damaging Het
Hspg2 A G 4: 137,550,932 Q3010R probably benign Het
Ice2 T A 9: 69,410,785 F223I possibly damaging Het
March11 A G 15: 26,409,237 T341A probably damaging Het
Mllt10 A G 2: 18,206,084 K770E probably damaging Het
Mug1 A G 6: 121,861,169 T453A probably benign Het
Myh15 C T 16: 49,155,646 T1359I probably benign Het
Nbn A G 4: 15,958,080 K3E probably damaging Het
Nlrp4a T C 7: 26,464,146 F913L probably benign Het
Nlrx1 G T 9: 44,264,789 A48D probably damaging Het
Noc3l C G 19: 38,795,003 G643A possibly damaging Het
Olfr1307 T C 2: 111,944,530 R309G probably benign Het
Olfr895 T A 9: 38,269,048 N170K probably benign Het
Pde6b G T 5: 108,419,773 probably null Het
Phactr1 A G 13: 43,077,729 I247V unknown Het
Pid1 G T 1: 84,116,024 Q48K probably benign Het
Ppfia2 A G 10: 106,863,372 N794S probably benign Het
Ppox G A 1: 171,279,972 S123L possibly damaging Het
Ptprd A C 4: 76,095,535 D778E probably benign Het
Rgs13 A G 1: 144,140,862 Y48H probably damaging Het
Rgs17 T A 10: 5,833,078 M190L probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Scaf8 C T 17: 3,197,207 P935L probably damaging Het
Slc22a6 T C 19: 8,623,889 I435T probably benign Het
Snx4 T C 16: 33,291,829 L378P probably damaging Het
Spns1 A G 7: 126,374,054 L155P probably damaging Het
St8sia4 T C 1: 95,653,595 T141A possibly damaging Het
Syt10 A T 15: 89,782,617 S510R probably damaging Het
Tmprss11d A T 5: 86,309,490 F241L probably benign Het
Tnfrsf21 A T 17: 43,037,925 T143S probably benign Het
Trim72 A G 7: 128,010,319 N431S probably benign Het
Usp43 A G 11: 67,855,789 S1031P probably damaging Het
Wdr75 A G 1: 45,819,639 Y656C probably benign Het
Zfp28 T C 7: 6,393,786 C407R probably damaging Het
Zfp804b C T 5: 6,771,866 R399Q possibly damaging Het
Zfp949 T A 9: 88,569,270 C298S probably damaging Het
Other mutations in Slc17a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Slc17a2 APN 13 23819334 missense probably benign 0.13
IGL01511:Slc17a2 APN 13 23819138 critical splice donor site probably null
IGL01624:Slc17a2 APN 13 23814986 missense probably benign 0.00
IGL01839:Slc17a2 APN 13 23812685 missense possibly damaging 0.91
IGL02010:Slc17a2 APN 13 23819042 missense probably benign 0.00
IGL03299:Slc17a2 APN 13 23821111 critical splice donor site probably null
R7808_slc17a2_962 UTSW 13 23819334 missense probably damaging 0.99
R0622:Slc17a2 UTSW 13 23812611 missense probably damaging 1.00
R1104:Slc17a2 UTSW 13 23819937 missense probably damaging 0.99
R1530:Slc17a2 UTSW 13 23819069 missense probably damaging 1.00
R1682:Slc17a2 UTSW 13 23812640 missense probably damaging 0.96
R2255:Slc17a2 UTSW 13 23821008 missense probably benign 0.09
R4923:Slc17a2 UTSW 13 23819095 missense probably benign 0.20
R5193:Slc17a2 UTSW 13 23819862 critical splice acceptor site probably null
R5321:Slc17a2 UTSW 13 23812631 missense possibly damaging 0.95
R5334:Slc17a2 UTSW 13 23819051 missense probably damaging 0.97
R5377:Slc17a2 UTSW 13 23812592 missense probably damaging 1.00
R6165:Slc17a2 UTSW 13 23815070 missense probably benign 0.00
R6280:Slc17a2 UTSW 13 23822394 missense probably benign
R6311:Slc17a2 UTSW 13 23815022 missense probably benign 0.40
R6323:Slc17a2 UTSW 13 23814986 missense probably benign 0.00
R6476:Slc17a2 UTSW 13 23812586 missense probably damaging 1.00
R6814:Slc17a2 UTSW 13 23822389 missense possibly damaging 0.55
R7155:Slc17a2 UTSW 13 23822407 missense probably benign 0.21
R7188:Slc17a2 UTSW 13 23822365 missense probably damaging 1.00
R7288:Slc17a2 UTSW 13 23819112 missense probably benign 0.09
R7462:Slc17a2 UTSW 13 23822418 missense probably damaging 1.00
R7808:Slc17a2 UTSW 13 23819334 missense probably damaging 0.99
R8444:Slc17a2 UTSW 13 23819078 missense probably benign 0.00
R8447:Slc17a2 UTSW 13 23822326 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGCAGCAGTTTCCTTTCAGGTG -3'
(R):5'- ATGACAGACTCAAGCAATGGC -3'

Sequencing Primer
(F):5'- AGGTGTTCATTCTGTAACCCTG -3'
(R):5'- TCTATAATCTGCAGAGTCAAGACTG -3'
Posted On2020-09-15