Incidental Mutation 'R7937:Chd8'
ID 648825
Institutional Source Beutler Lab
Gene Symbol Chd8
Ensembl Gene ENSMUSG00000053754
Gene Name chromodomain helicase DNA binding protein 8
Synonyms Duplin, 5830451P18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7937 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 52198151-52257780 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 52227506 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 633 (F633L)
Ref Sequence ENSEMBL: ENSMUSP00000087184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000200169]
AlphaFold Q09XV5
Predicted Effect probably benign
Transcript: ENSMUST00000089752
AA Change: F633L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: F633L

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200169
AA Change: F633L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: F633L

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,331,011 W32R possibly damaging Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Ano6 C A 15: 95,972,589 T875K probably damaging Het
Armc8 G A 9: 99,536,219 T94I probably damaging Het
Ash1l C T 3: 89,070,317 R2685* probably null Het
Bri3bp A T 5: 125,454,331 N114Y probably damaging Het
Camkk2 G T 5: 122,764,034 Q71K probably benign Het
Cc2d2b T C 19: 40,777,292 F49S Het
Cdh10 A G 15: 18,964,249 T166A probably benign Het
Cntn5 G A 9: 9,748,445 T477I probably damaging Het
Cyp2c37 T A 19: 39,993,758 Y68N probably damaging Het
Dnah2 A T 11: 69,517,685 L53* probably null Het
Dnajc11 A G 4: 151,950,452 D44G probably damaging Het
Elovl3 T C 19: 46,134,729 F248S probably damaging Het
Etfdh A G 3: 79,609,816 L422P probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fgd4 A G 16: 16,469,773 Y355H probably damaging Het
Fgfr2 A G 7: 130,219,093 M237T probably damaging Het
Gdap1 A T 1: 17,159,953 K203N probably benign Het
Glis1 A G 4: 107,627,526 D594G possibly damaging Het
Gm4787 T A 12: 81,377,905 H493L probably benign Het
Gpatch3 G T 4: 133,582,997 V418L probably damaging Het
Greb1 T C 12: 16,716,669 N376S probably damaging Het
Hspg2 A G 4: 137,550,932 Q3010R probably benign Het
Ice2 T A 9: 69,410,785 F223I possibly damaging Het
March11 A G 15: 26,409,237 T341A probably damaging Het
Mllt10 A G 2: 18,206,084 K770E probably damaging Het
Mug1 A G 6: 121,861,169 T453A probably benign Het
Myh15 C T 16: 49,155,646 T1359I probably benign Het
Nbn A G 4: 15,958,080 K3E probably damaging Het
Nlrp4a T C 7: 26,464,146 F913L probably benign Het
Nlrx1 G T 9: 44,264,789 A48D probably damaging Het
Noc3l C G 19: 38,795,003 G643A possibly damaging Het
Olfr1307 T C 2: 111,944,530 R309G probably benign Het
Olfr895 T A 9: 38,269,048 N170K probably benign Het
Pde6b G T 5: 108,419,773 probably null Het
Phactr1 A G 13: 43,077,729 I247V unknown Het
Pid1 G T 1: 84,116,024 Q48K probably benign Het
Ppfia2 A G 10: 106,863,372 N794S probably benign Het
Ppox G A 1: 171,279,972 S123L possibly damaging Het
Ptprd A C 4: 76,095,535 D778E probably benign Het
Rgs13 A G 1: 144,140,862 Y48H probably damaging Het
Rgs17 T A 10: 5,833,078 M190L probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Scaf8 C T 17: 3,197,207 P935L probably damaging Het
Slc17a2 A G 13: 23,812,665 H51R probably benign Het
Slc22a6 T C 19: 8,623,889 I435T probably benign Het
Snx4 T C 16: 33,291,829 L378P probably damaging Het
Spns1 A G 7: 126,374,054 L155P probably damaging Het
St8sia4 T C 1: 95,653,595 T141A possibly damaging Het
Syt10 A T 15: 89,782,617 S510R probably damaging Het
Tmprss11d A T 5: 86,309,490 F241L probably benign Het
Tnfrsf21 A T 17: 43,037,925 T143S probably benign Het
Trim72 A G 7: 128,010,319 N431S probably benign Het
Usp43 A G 11: 67,855,789 S1031P probably damaging Het
Wdr75 A G 1: 45,819,639 Y656C probably benign Het
Zfp28 T C 7: 6,393,786 C407R probably damaging Het
Zfp804b C T 5: 6,771,866 R399Q possibly damaging Het
Zfp949 T A 9: 88,569,270 C298S probably damaging Het
Other mutations in Chd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Chd8 APN 14 52226138 missense probably damaging 0.99
IGL00694:Chd8 APN 14 52217970 missense probably damaging 1.00
IGL01011:Chd8 APN 14 52231532 missense possibly damaging 0.86
IGL01022:Chd8 APN 14 52236993 missense probably benign
IGL01066:Chd8 APN 14 52217766 missense probably damaging 1.00
IGL01083:Chd8 APN 14 52221420 missense probably damaging 1.00
IGL01313:Chd8 APN 14 52210575 missense probably damaging 1.00
IGL01396:Chd8 APN 14 52204587 unclassified probably benign
IGL01476:Chd8 APN 14 52205490 missense probably benign 0.32
IGL01731:Chd8 APN 14 52212654 missense probably benign 0.12
IGL01895:Chd8 APN 14 52199094 missense probably benign 0.00
IGL02090:Chd8 APN 14 52227234 critical splice donor site probably null
IGL02344:Chd8 APN 14 52201650 missense probably damaging 1.00
IGL02573:Chd8 APN 14 52219734 missense possibly damaging 0.95
IGL02601:Chd8 APN 14 52214300 missense possibly damaging 0.94
IGL02617:Chd8 APN 14 52235191 missense probably benign 0.34
IGL02873:Chd8 APN 14 52222513 missense probably damaging 0.99
IGL02974:Chd8 APN 14 52201701 splice site probably null
IGL03058:Chd8 APN 14 52218273 missense probably damaging 1.00
IGL03076:Chd8 APN 14 52226162 splice site probably benign
IGL03239:Chd8 APN 14 52227548 missense possibly damaging 0.92
PIT4431001:Chd8 UTSW 14 52218249 missense probably damaging 0.98
PIT4468001:Chd8 UTSW 14 52207996 missense probably benign
PIT4468001:Chd8 UTSW 14 52217881 missense possibly damaging 0.95
R0006:Chd8 UTSW 14 52235293 missense possibly damaging 0.51
R0006:Chd8 UTSW 14 52235293 missense possibly damaging 0.51
R0022:Chd8 UTSW 14 52232855 missense probably benign 0.00
R0115:Chd8 UTSW 14 52237206 missense probably benign 0.00
R0131:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0131:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0132:Chd8 UTSW 14 52205326 missense probably benign 0.15
R0419:Chd8 UTSW 14 52204060 missense probably benign 0.24
R0440:Chd8 UTSW 14 52204826 missense possibly damaging 0.91
R0452:Chd8 UTSW 14 52214587 missense probably damaging 1.00
R0481:Chd8 UTSW 14 52237206 missense probably benign 0.00
R0624:Chd8 UTSW 14 52219757 missense possibly damaging 0.65
R0650:Chd8 UTSW 14 52202304 missense probably benign 0.09
R0691:Chd8 UTSW 14 52213433 missense probably damaging 0.96
R0790:Chd8 UTSW 14 52204025 missense probably benign 0.07
R0835:Chd8 UTSW 14 52204025 missense probably benign 0.07
R1180:Chd8 UTSW 14 52221108 missense probably damaging 1.00
R1411:Chd8 UTSW 14 52224646 missense probably benign
R1725:Chd8 UTSW 14 52232573 missense probably benign 0.08
R1838:Chd8 UTSW 14 52204883 missense probably benign 0.11
R1839:Chd8 UTSW 14 52204883 missense probably benign 0.11
R1968:Chd8 UTSW 14 52220993 missense probably damaging 0.98
R2020:Chd8 UTSW 14 52215241 missense probably damaging 1.00
R2024:Chd8 UTSW 14 52231493 missense probably benign 0.23
R2139:Chd8 UTSW 14 52236971 missense probably benign 0.32
R2163:Chd8 UTSW 14 52198818 missense possibly damaging 0.53
R2342:Chd8 UTSW 14 52205217 missense probably benign 0.25
R2844:Chd8 UTSW 14 52204495 missense possibly damaging 0.92
R3500:Chd8 UTSW 14 52205653 missense probably benign 0.00
R3861:Chd8 UTSW 14 52237121 missense probably benign 0.13
R4154:Chd8 UTSW 14 52207211 unclassified probably benign
R4445:Chd8 UTSW 14 52204527 splice site probably null
R4628:Chd8 UTSW 14 52206915 missense probably benign 0.03
R4779:Chd8 UTSW 14 52231506 missense probably damaging 1.00
R4783:Chd8 UTSW 14 52205368 missense probably damaging 1.00
R4784:Chd8 UTSW 14 52205368 missense probably damaging 1.00
R5001:Chd8 UTSW 14 52203915 missense probably benign 0.09
R5280:Chd8 UTSW 14 52205125 missense possibly damaging 0.68
R5331:Chd8 UTSW 14 52202114 intron probably benign
R5348:Chd8 UTSW 14 52232698 missense probably damaging 1.00
R5375:Chd8 UTSW 14 52204154 missense probably damaging 1.00
R5470:Chd8 UTSW 14 52212609 missense probably damaging 1.00
R5479:Chd8 UTSW 14 52215195 missense probably benign 0.15
R5488:Chd8 UTSW 14 52213048 intron probably benign
R5489:Chd8 UTSW 14 52213048 intron probably benign
R5499:Chd8 UTSW 14 52204431 critical splice donor site probably null
R5988:Chd8 UTSW 14 52217938 missense probably damaging 1.00
R6046:Chd8 UTSW 14 52221071 missense possibly damaging 0.60
R6125:Chd8 UTSW 14 52207034 missense probably benign 0.16
R6212:Chd8 UTSW 14 52201698 missense probably damaging 1.00
R6337:Chd8 UTSW 14 52204109 missense probably damaging 1.00
R6394:Chd8 UTSW 14 52202585 missense possibly damaging 0.66
R6576:Chd8 UTSW 14 52216076 missense probably damaging 1.00
R6590:Chd8 UTSW 14 52227237 missense possibly damaging 0.60
R6690:Chd8 UTSW 14 52227237 missense possibly damaging 0.60
R6786:Chd8 UTSW 14 52226668 missense probably benign 0.33
R6913:Chd8 UTSW 14 52214494 missense probably damaging 0.99
R7090:Chd8 UTSW 14 52215220 missense probably damaging 0.99
R7107:Chd8 UTSW 14 52212672 missense probably benign 0.07
R7138:Chd8 UTSW 14 52214498 missense possibly damaging 0.83
R7383:Chd8 UTSW 14 52215319 missense probably damaging 1.00
R7392:Chd8 UTSW 14 52232855 missense probably benign
R7471:Chd8 UTSW 14 52204112 missense probably benign
R7625:Chd8 UTSW 14 52237077 missense probably benign 0.04
R7790:Chd8 UTSW 14 52226082 missense probably damaging 1.00
R7862:Chd8 UTSW 14 52214277 missense probably damaging 1.00
R8092:Chd8 UTSW 14 52217727 missense probably damaging 1.00
R8237:Chd8 UTSW 14 52213352 missense probably damaging 1.00
R8321:Chd8 UTSW 14 52232567 missense probably benign 0.01
R8371:Chd8 UTSW 14 52232818 missense probably benign
R8425:Chd8 UTSW 14 52210555 missense probably damaging 1.00
R8674:Chd8 UTSW 14 52213006 missense probably damaging 0.98
R8794:Chd8 UTSW 14 52204447 missense probably damaging 0.98
R8828:Chd8 UTSW 14 52210580 frame shift probably null
R8909:Chd8 UTSW 14 52212932 missense possibly damaging 0.82
R9194:Chd8 UTSW 14 52202193 missense probably benign 0.01
R9278:Chd8 UTSW 14 52235170 missense probably benign 0.01
R9489:Chd8 UTSW 14 52219598 missense probably damaging 0.98
R9501:Chd8 UTSW 14 52214588 missense probably benign 0.04
R9546:Chd8 UTSW 14 52215951 missense probably damaging 1.00
R9605:Chd8 UTSW 14 52219598 missense probably damaging 0.98
R9694:Chd8 UTSW 14 52203884 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GTCCACAATAGCTGCATCTTC -3'
(R):5'- GAGACGTTCAAACCGCCAAG -3'

Sequencing Primer
(F):5'- CTCCTGTAGCAAAAGATGTTGTC -3'
(R):5'- GAGACGTTCAAACCGCCAAGTTAAG -3'
Posted On 2020-09-15