Mutagenetix > Incidental Mutation

Incidental Mutation 'R7937:Chd8'

648825

Institutional Source

Beutler Lab

Gene Symbol

Chd8

Ensembl Gene

ENSMUSG00000053754

Gene Name

chromodomain helicase DNA binding protein 8

Synonyms

Duplin, 5830451P18Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7937 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

52198151-52257780 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52227506 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 633 (F633L)

Ref Sequence

ENSEMBL: ENSMUSP00000087184 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000200169]

AlphaFold

Q09XV5

Predicted Effect

probably benign
Transcript: ENSMUST00000089752
AA Change: F633L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: F633L

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200169
AA Change: F633L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: F633L

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	A	G	6: 129,331,011	W32R	possibly damaging	Het
Abcb11	GTTGATCCATACA	G	2: 69,323,873		probably benign	Het
Ano6	C	A	15: 95,972,589	T875K	probably damaging	Het
Armc8	G	A	9: 99,536,219	T94I	probably damaging	Het
Ash1l	C	T	3: 89,070,317	R2685*	probably null	Het
Bri3bp	A	T	5: 125,454,331	N114Y	probably damaging	Het
Camkk2	G	T	5: 122,764,034	Q71K	probably benign	Het
Cc2d2b	T	C	19: 40,777,292	F49S		Het
Cdh10	A	G	15: 18,964,249	T166A	probably benign	Het
Cntn5	G	A	9: 9,748,445	T477I	probably damaging	Het
Cyp2c37	T	A	19: 39,993,758	Y68N	probably damaging	Het
Dnah2	A	T	11: 69,517,685	L53*	probably null	Het
Dnajc11	A	G	4: 151,950,452	D44G	probably damaging	Het
Elovl3	T	C	19: 46,134,729	F248S	probably damaging	Het
Etfdh	A	G	3: 79,609,816	L422P	probably benign	Het
Fam184a	C	A	10: 53,633,706	E126*	probably null	Het
Fgd4	A	G	16: 16,469,773	Y355H	probably damaging	Het
Fgfr2	A	G	7: 130,219,093	M237T	probably damaging	Het
Gdap1	A	T	1: 17,159,953	K203N	probably benign	Het
Glis1	A	G	4: 107,627,526	D594G	possibly damaging	Het
Gm4787	T	A	12: 81,377,905	H493L	probably benign	Het
Gpatch3	G	T	4: 133,582,997	V418L	probably damaging	Het
Greb1	T	C	12: 16,716,669	N376S	probably damaging	Het
Hspg2	A	G	4: 137,550,932	Q3010R	probably benign	Het
Ice2	T	A	9: 69,410,785	F223I	possibly damaging	Het
March11	A	G	15: 26,409,237	T341A	probably damaging	Het
Mllt10	A	G	2: 18,206,084	K770E	probably damaging	Het
Mug1	A	G	6: 121,861,169	T453A	probably benign	Het
Myh15	C	T	16: 49,155,646	T1359I	probably benign	Het
Nbn	A	G	4: 15,958,080	K3E	probably damaging	Het
Nlrp4a	T	C	7: 26,464,146	F913L	probably benign	Het
Nlrx1	G	T	9: 44,264,789	A48D	probably damaging	Het
Noc3l	C	G	19: 38,795,003	G643A	possibly damaging	Het
Olfr1307	T	C	2: 111,944,530	R309G	probably benign	Het
Olfr895	T	A	9: 38,269,048	N170K	probably benign	Het
Pde6b	G	T	5: 108,419,773		probably null	Het
Phactr1	A	G	13: 43,077,729	I247V	unknown	Het
Pid1	G	T	1: 84,116,024	Q48K	probably benign	Het
Ppfia2	A	G	10: 106,863,372	N794S	probably benign	Het
Ppox	G	A	1: 171,279,972	S123L	possibly damaging	Het
Ptprd	A	C	4: 76,095,535	D778E	probably benign	Het
Rgs13	A	G	1: 144,140,862	Y48H	probably damaging	Het
Rgs17	T	A	10: 5,833,078	M190L	probably benign	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Scaf8	C	T	17: 3,197,207	P935L	probably damaging	Het
Slc17a2	A	G	13: 23,812,665	H51R	probably benign	Het
Slc22a6	T	C	19: 8,623,889	I435T	probably benign	Het
Snx4	T	C	16: 33,291,829	L378P	probably damaging	Het
Spns1	A	G	7: 126,374,054	L155P	probably damaging	Het
St8sia4	T	C	1: 95,653,595	T141A	possibly damaging	Het
Syt10	A	T	15: 89,782,617	S510R	probably damaging	Het
Tmprss11d	A	T	5: 86,309,490	F241L	probably benign	Het
Tnfrsf21	A	T	17: 43,037,925	T143S	probably benign	Het
Trim72	A	G	7: 128,010,319	N431S	probably benign	Het
Usp43	A	G	11: 67,855,789	S1031P	probably damaging	Het
Wdr75	A	G	1: 45,819,639	Y656C	probably benign	Het
Zfp28	T	C	7: 6,393,786	C407R	probably damaging	Het
Zfp804b	C	T	5: 6,771,866	R399Q	possibly damaging	Het
Zfp949	T	A	9: 88,569,270	C298S	probably damaging	Het

Other mutations in Chd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Chd8	APN	14	52226138	missense	probably damaging	0.99
IGL00694:Chd8	APN	14	52217970	missense	probably damaging	1.00
IGL01011:Chd8	APN	14	52231532	missense	possibly damaging	0.86
IGL01022:Chd8	APN	14	52236993	missense	probably benign
IGL01066:Chd8	APN	14	52217766	missense	probably damaging	1.00
IGL01083:Chd8	APN	14	52221420	missense	probably damaging	1.00
IGL01313:Chd8	APN	14	52210575	missense	probably damaging	1.00
IGL01396:Chd8	APN	14	52204587	unclassified	probably benign
IGL01476:Chd8	APN	14	52205490	missense	probably benign	0.32
IGL01731:Chd8	APN	14	52212654	missense	probably benign	0.12
IGL01895:Chd8	APN	14	52199094	missense	probably benign	0.00
IGL02090:Chd8	APN	14	52227234	critical splice donor site	probably null
IGL02344:Chd8	APN	14	52201650	missense	probably damaging	1.00
IGL02573:Chd8	APN	14	52219734	missense	possibly damaging	0.95
IGL02601:Chd8	APN	14	52214300	missense	possibly damaging	0.94
IGL02617:Chd8	APN	14	52235191	missense	probably benign	0.34
IGL02873:Chd8	APN	14	52222513	missense	probably damaging	0.99
IGL02974:Chd8	APN	14	52201701	splice site	probably null
IGL03058:Chd8	APN	14	52218273	missense	probably damaging	1.00
IGL03076:Chd8	APN	14	52226162	splice site	probably benign
IGL03239:Chd8	APN	14	52227548	missense	possibly damaging	0.92
PIT4431001:Chd8	UTSW	14	52218249	missense	probably damaging	0.98
PIT4468001:Chd8	UTSW	14	52207996	missense	probably benign
PIT4468001:Chd8	UTSW	14	52217881	missense	possibly damaging	0.95
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0022:Chd8	UTSW	14	52232855	missense	probably benign	0.00
R0115:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0132:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0419:Chd8	UTSW	14	52204060	missense	probably benign	0.24
R0440:Chd8	UTSW	14	52204826	missense	possibly damaging	0.91
R0452:Chd8	UTSW	14	52214587	missense	probably damaging	1.00
R0481:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0624:Chd8	UTSW	14	52219757	missense	possibly damaging	0.65
R0650:Chd8	UTSW	14	52202304	missense	probably benign	0.09
R0691:Chd8	UTSW	14	52213433	missense	probably damaging	0.96
R0790:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R0835:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R1180:Chd8	UTSW	14	52221108	missense	probably damaging	1.00
R1411:Chd8	UTSW	14	52224646	missense	probably benign
R1725:Chd8	UTSW	14	52232573	missense	probably benign	0.08
R1838:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1839:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1968:Chd8	UTSW	14	52220993	missense	probably damaging	0.98
R2020:Chd8	UTSW	14	52215241	missense	probably damaging	1.00
R2024:Chd8	UTSW	14	52231493	missense	probably benign	0.23
R2139:Chd8	UTSW	14	52236971	missense	probably benign	0.32
R2163:Chd8	UTSW	14	52198818	missense	possibly damaging	0.53
R2342:Chd8	UTSW	14	52205217	missense	probably benign	0.25
R2844:Chd8	UTSW	14	52204495	missense	possibly damaging	0.92
R3500:Chd8	UTSW	14	52205653	missense	probably benign	0.00
R3861:Chd8	UTSW	14	52237121	missense	probably benign	0.13
R4154:Chd8	UTSW	14	52207211	unclassified	probably benign
R4445:Chd8	UTSW	14	52204527	splice site	probably null
R4628:Chd8	UTSW	14	52206915	missense	probably benign	0.03
R4779:Chd8	UTSW	14	52231506	missense	probably damaging	1.00
R4783:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R4784:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R5001:Chd8	UTSW	14	52203915	missense	probably benign	0.09
R5280:Chd8	UTSW	14	52205125	missense	possibly damaging	0.68
R5331:Chd8	UTSW	14	52202114	intron	probably benign
R5348:Chd8	UTSW	14	52232698	missense	probably damaging	1.00
R5375:Chd8	UTSW	14	52204154	missense	probably damaging	1.00
R5470:Chd8	UTSW	14	52212609	missense	probably damaging	1.00
R5479:Chd8	UTSW	14	52215195	missense	probably benign	0.15
R5488:Chd8	UTSW	14	52213048	intron	probably benign
R5489:Chd8	UTSW	14	52213048	intron	probably benign
R5499:Chd8	UTSW	14	52204431	critical splice donor site	probably null
R5988:Chd8	UTSW	14	52217938	missense	probably damaging	1.00
R6046:Chd8	UTSW	14	52221071	missense	possibly damaging	0.60
R6125:Chd8	UTSW	14	52207034	missense	probably benign	0.16
R6212:Chd8	UTSW	14	52201698	missense	probably damaging	1.00
R6337:Chd8	UTSW	14	52204109	missense	probably damaging	1.00
R6394:Chd8	UTSW	14	52202585	missense	possibly damaging	0.66
R6576:Chd8	UTSW	14	52216076	missense	probably damaging	1.00
R6590:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6690:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6786:Chd8	UTSW	14	52226668	missense	probably benign	0.33
R6913:Chd8	UTSW	14	52214494	missense	probably damaging	0.99
R7090:Chd8	UTSW	14	52215220	missense	probably damaging	0.99
R7107:Chd8	UTSW	14	52212672	missense	probably benign	0.07
R7138:Chd8	UTSW	14	52214498	missense	possibly damaging	0.83
R7383:Chd8	UTSW	14	52215319	missense	probably damaging	1.00
R7392:Chd8	UTSW	14	52232855	missense	probably benign
R7471:Chd8	UTSW	14	52204112	missense	probably benign
R7625:Chd8	UTSW	14	52237077	missense	probably benign	0.04
R7790:Chd8	UTSW	14	52226082	missense	probably damaging	1.00
R7862:Chd8	UTSW	14	52214277	missense	probably damaging	1.00
R8092:Chd8	UTSW	14	52217727	missense	probably damaging	1.00
R8237:Chd8	UTSW	14	52213352	missense	probably damaging	1.00
R8321:Chd8	UTSW	14	52232567	missense	probably benign	0.01
R8371:Chd8	UTSW	14	52232818	missense	probably benign
R8425:Chd8	UTSW	14	52210555	missense	probably damaging	1.00
R8674:Chd8	UTSW	14	52213006	missense	probably damaging	0.98
R8794:Chd8	UTSW	14	52204447	missense	probably damaging	0.98
R8828:Chd8	UTSW	14	52210580	frame shift	probably null
R8909:Chd8	UTSW	14	52212932	missense	possibly damaging	0.82
R9194:Chd8	UTSW	14	52202193	missense	probably benign	0.01
R9278:Chd8	UTSW	14	52235170	missense	probably benign	0.01
R9489:Chd8	UTSW	14	52219598	missense	probably damaging	0.98
R9501:Chd8	UTSW	14	52214588	missense	probably benign	0.04
R9546:Chd8	UTSW	14	52215951	missense	probably damaging	1.00
R9605:Chd8	UTSW	14	52219598	missense	probably damaging	0.98
R9694:Chd8	UTSW	14	52203884	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- GTCCACAATAGCTGCATCTTC -3'
(R):5'- GAGACGTTCAAACCGCCAAG -3'

Sequencing Primer
(F):5'- CTCCTGTAGCAAAAGATGTTGTC -3'
(R):5'- GAGACGTTCAAACCGCCAAGTTAAG -3'

Posted On

2020-09-15