Incidental Mutation 'R7937:Rictor'
ID 648826
Institutional Source Beutler Lab
Gene Symbol Rictor
Ensembl Gene ENSMUSG00000050310
Gene Name RPTOR independent companion of MTOR, complex 2
Synonyms D530039E11Rik, 4921505C17Rik, 6030405M08Rik
MMRRC Submission 045983-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7937 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 6737860-6829882 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 6801635 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 441 (S441L)
Ref Sequence ENSEMBL: ENSMUSP00000051809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061656]
AlphaFold Q6QI06
Predicted Effect probably benign
Transcript: ENSMUST00000061656
AA Change: S441L

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310
AA Change: S441L

DomainStartEndE-ValueType
RICTOR_N 57 439 4.02e-185 SMART
RICTOR_M 523 742 5.66e-98 SMART
RasGEF_N_2 743 857 1.26e-54 SMART
RICTOR_V 920 992 1.44e-40 SMART
low complexity region 1019 1043 N/A INTRINSIC
RICTOR_phospho 1084 1189 4.06e-58 SMART
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1255 1266 N/A INTRINSIC
low complexity region 1273 1287 N/A INTRINSIC
low complexity region 1404 1414 N/A INTRINSIC
low complexity region 1464 1474 N/A INTRINSIC
low complexity region 1616 1628 N/A INTRINSIC
Meta Mutation Damage Score 0.1015 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 GTTGATCCATACA G 2: 69,154,217 (GRCm39) probably benign Het
Ano6 C A 15: 95,870,470 (GRCm39) T875K probably damaging Het
Armc8 G A 9: 99,418,272 (GRCm39) T94I probably damaging Het
Ash1l C T 3: 88,977,624 (GRCm39) R2685* probably null Het
Bri3bp A T 5: 125,531,395 (GRCm39) N114Y probably damaging Het
Camkk2 G T 5: 122,902,097 (GRCm39) Q71K probably benign Het
Cc2d2b T C 19: 40,765,736 (GRCm39) F49S Het
Cdh10 A G 15: 18,964,335 (GRCm39) T166A probably benign Het
Chd8 A G 14: 52,464,963 (GRCm39) F633L probably benign Het
Clec2m A G 6: 129,307,974 (GRCm39) W32R possibly damaging Het
Cntn5 G A 9: 9,748,450 (GRCm39) T477I probably damaging Het
Cyp2c37 T A 19: 39,982,202 (GRCm39) Y68N probably damaging Het
Dnah2 A T 11: 69,408,511 (GRCm39) L53* probably null Het
Dnajc11 A G 4: 152,034,909 (GRCm39) D44G probably damaging Het
Elovl3 T C 19: 46,123,168 (GRCm39) F248S probably damaging Het
Etfdh A G 3: 79,517,123 (GRCm39) L422P probably benign Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fgd4 A G 16: 16,287,637 (GRCm39) Y355H probably damaging Het
Fgfr2 A G 7: 129,820,823 (GRCm39) M237T probably damaging Het
Gdap1 A T 1: 17,230,177 (GRCm39) K203N probably benign Het
Glis1 A G 4: 107,484,723 (GRCm39) D594G possibly damaging Het
Gm4787 T A 12: 81,424,679 (GRCm39) H493L probably benign Het
Gpatch3 G T 4: 133,310,308 (GRCm39) V418L probably damaging Het
Greb1 T C 12: 16,766,670 (GRCm39) N376S probably damaging Het
Hspg2 A G 4: 137,278,243 (GRCm39) Q3010R probably benign Het
Ice2 T A 9: 69,318,067 (GRCm39) F223I possibly damaging Het
Marchf11 A G 15: 26,409,323 (GRCm39) T341A probably damaging Het
Mllt10 A G 2: 18,210,895 (GRCm39) K770E probably damaging Het
Mug1 A G 6: 121,838,128 (GRCm39) T453A probably benign Het
Myh15 C T 16: 48,976,009 (GRCm39) T1359I probably benign Het
Nbn A G 4: 15,958,080 (GRCm39) K3E probably damaging Het
Nlrp4a T C 7: 26,163,571 (GRCm39) F913L probably benign Het
Nlrx1 G T 9: 44,176,086 (GRCm39) A48D probably damaging Het
Noc3l C G 19: 38,783,447 (GRCm39) G643A possibly damaging Het
Or4f14b T C 2: 111,774,875 (GRCm39) R309G probably benign Het
Or8c17 T A 9: 38,180,344 (GRCm39) N170K probably benign Het
Pde6b G T 5: 108,567,639 (GRCm39) probably null Het
Phactr1 A G 13: 43,231,205 (GRCm39) I247V unknown Het
Pid1 G T 1: 84,093,745 (GRCm39) Q48K probably benign Het
Ppfia2 A G 10: 106,699,233 (GRCm39) N794S probably benign Het
Ppox G A 1: 171,107,546 (GRCm39) S123L possibly damaging Het
Ptprd A C 4: 76,013,772 (GRCm39) D778E probably benign Het
Rgs13 A G 1: 144,016,600 (GRCm39) Y48H probably damaging Het
Rgs17 T A 10: 5,783,078 (GRCm39) M190L probably benign Het
Scaf8 C T 17: 3,247,482 (GRCm39) P935L probably damaging Het
Slc22a6 T C 19: 8,601,253 (GRCm39) I435T probably benign Het
Slc34a1 A G 13: 23,996,648 (GRCm39) H51R probably benign Het
Snx4 T C 16: 33,112,199 (GRCm39) L378P probably damaging Het
Spns1 A G 7: 125,973,226 (GRCm39) L155P probably damaging Het
St8sia4 T C 1: 95,581,320 (GRCm39) T141A possibly damaging Het
Syt10 A T 15: 89,666,820 (GRCm39) S510R probably damaging Het
Tmprss11d A T 5: 86,457,349 (GRCm39) F241L probably benign Het
Tnfrsf21 A T 17: 43,348,816 (GRCm39) T143S probably benign Het
Trim72 A G 7: 127,609,491 (GRCm39) N431S probably benign Het
Usp43 A G 11: 67,746,615 (GRCm39) S1031P probably damaging Het
Wdr75 A G 1: 45,858,799 (GRCm39) Y656C probably benign Het
Zfp28 T C 7: 6,396,785 (GRCm39) C407R probably damaging Het
Zfp804b C T 5: 6,821,866 (GRCm39) R399Q possibly damaging Het
Zfp949 T A 9: 88,451,323 (GRCm39) C298S probably damaging Het
Other mutations in Rictor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rictor APN 15 6,816,071 (GRCm39) missense probably damaging 0.99
IGL00785:Rictor APN 15 6,806,431 (GRCm39) missense probably damaging 1.00
IGL00801:Rictor APN 15 6,824,015 (GRCm39) missense probably damaging 1.00
IGL01072:Rictor APN 15 6,819,043 (GRCm39) missense probably damaging 0.98
IGL01139:Rictor APN 15 6,807,749 (GRCm39) missense probably damaging 1.00
IGL01303:Rictor APN 15 6,738,119 (GRCm39) missense probably benign 0.10
IGL01307:Rictor APN 15 6,804,085 (GRCm39) splice site probably null
IGL01767:Rictor APN 15 6,806,865 (GRCm39) missense probably damaging 1.00
IGL01774:Rictor APN 15 6,799,258 (GRCm39) missense probably damaging 1.00
IGL01800:Rictor APN 15 6,804,182 (GRCm39) missense probably damaging 0.99
IGL02192:Rictor APN 15 6,815,895 (GRCm39) missense probably benign 0.00
IGL02503:Rictor APN 15 6,815,924 (GRCm39) missense probably benign 0.06
IGL02652:Rictor APN 15 6,805,668 (GRCm39) critical splice donor site probably null
IGL02656:Rictor APN 15 6,806,401 (GRCm39) missense probably damaging 0.98
IGL02752:Rictor APN 15 6,816,852 (GRCm39) missense probably benign 0.02
IGL03000:Rictor APN 15 6,798,721 (GRCm39) splice site probably benign
IGL03118:Rictor APN 15 6,788,999 (GRCm39) missense possibly damaging 0.93
IGL03182:Rictor APN 15 6,819,079 (GRCm39) missense probably benign 0.08
Tense UTSW 15 6,788,977 (GRCm39) missense possibly damaging 0.94
Tonus UTSW 15 6,798,815 (GRCm39) critical splice donor site probably null
Torrid UTSW 15 6,789,053 (GRCm39) missense probably damaging 1.00
R0149:Rictor UTSW 15 6,813,588 (GRCm39) missense possibly damaging 0.76
R0288:Rictor UTSW 15 6,816,021 (GRCm39) missense probably benign 0.08
R0304:Rictor UTSW 15 6,815,852 (GRCm39) splice site probably null
R0336:Rictor UTSW 15 6,806,234 (GRCm39) critical splice acceptor site probably null
R0361:Rictor UTSW 15 6,813,588 (GRCm39) missense possibly damaging 0.76
R0423:Rictor UTSW 15 6,803,381 (GRCm39) missense possibly damaging 0.77
R0453:Rictor UTSW 15 6,738,123 (GRCm39) missense probably benign 0.01
R0515:Rictor UTSW 15 6,798,782 (GRCm39) missense probably damaging 1.00
R0630:Rictor UTSW 15 6,823,973 (GRCm39) missense probably damaging 1.00
R0730:Rictor UTSW 15 6,803,467 (GRCm39) splice site probably benign
R0744:Rictor UTSW 15 6,793,759 (GRCm39) critical splice acceptor site probably null
R0836:Rictor UTSW 15 6,793,759 (GRCm39) critical splice acceptor site probably null
R0881:Rictor UTSW 15 6,821,151 (GRCm39) missense probably benign
R1114:Rictor UTSW 15 6,823,486 (GRCm39) nonsense probably null
R1367:Rictor UTSW 15 6,820,119 (GRCm39) splice site probably benign
R1655:Rictor UTSW 15 6,801,693 (GRCm39) missense probably benign 0.00
R1678:Rictor UTSW 15 6,785,952 (GRCm39) missense probably benign 0.07
R1679:Rictor UTSW 15 6,797,571 (GRCm39) missense possibly damaging 0.92
R1754:Rictor UTSW 15 6,764,849 (GRCm39) missense probably damaging 1.00
R1757:Rictor UTSW 15 6,803,343 (GRCm39) missense possibly damaging 0.95
R1762:Rictor UTSW 15 6,786,054 (GRCm39) missense probably benign 0.00
R1914:Rictor UTSW 15 6,789,053 (GRCm39) missense probably damaging 1.00
R1915:Rictor UTSW 15 6,789,053 (GRCm39) missense probably damaging 1.00
R1994:Rictor UTSW 15 6,805,637 (GRCm39) missense probably benign 0.18
R2145:Rictor UTSW 15 6,794,588 (GRCm39) missense probably damaging 1.00
R2182:Rictor UTSW 15 6,801,685 (GRCm39) missense probably damaging 0.96
R2191:Rictor UTSW 15 6,789,095 (GRCm39) missense probably benign 0.04
R2357:Rictor UTSW 15 6,813,043 (GRCm39) missense probably damaging 0.99
R2914:Rictor UTSW 15 6,799,476 (GRCm39) critical splice donor site probably null
R3082:Rictor UTSW 15 6,804,338 (GRCm39) missense probably benign 0.15
R3885:Rictor UTSW 15 6,789,091 (GRCm39) missense probably damaging 1.00
R3900:Rictor UTSW 15 6,818,954 (GRCm39) missense probably benign 0.01
R4376:Rictor UTSW 15 6,816,448 (GRCm39) missense probably benign 0.00
R4611:Rictor UTSW 15 6,816,625 (GRCm39) missense possibly damaging 0.75
R4644:Rictor UTSW 15 6,807,416 (GRCm39) nonsense probably null
R4718:Rictor UTSW 15 6,812,641 (GRCm39) missense possibly damaging 0.81
R4822:Rictor UTSW 15 6,821,161 (GRCm39) missense probably benign 0.01
R4980:Rictor UTSW 15 6,811,141 (GRCm39) missense probably damaging 1.00
R5034:Rictor UTSW 15 6,797,576 (GRCm39) missense probably damaging 0.98
R5179:Rictor UTSW 15 6,825,421 (GRCm39) missense probably damaging 1.00
R5386:Rictor UTSW 15 6,818,985 (GRCm39) missense probably benign 0.37
R5532:Rictor UTSW 15 6,819,046 (GRCm39) missense probably damaging 1.00
R5549:Rictor UTSW 15 6,816,391 (GRCm39) missense probably damaging 1.00
R5715:Rictor UTSW 15 6,780,197 (GRCm39) nonsense probably null
R5733:Rictor UTSW 15 6,812,585 (GRCm39) missense probably benign
R5822:Rictor UTSW 15 6,823,487 (GRCm39) missense probably benign 0.00
R5848:Rictor UTSW 15 6,823,487 (GRCm39) missense probably benign 0.00
R5849:Rictor UTSW 15 6,823,487 (GRCm39) missense probably benign 0.00
R5850:Rictor UTSW 15 6,823,487 (GRCm39) missense probably benign 0.00
R5854:Rictor UTSW 15 6,823,487 (GRCm39) missense probably benign 0.00
R5855:Rictor UTSW 15 6,823,487 (GRCm39) missense probably benign 0.00
R5856:Rictor UTSW 15 6,823,487 (GRCm39) missense probably benign 0.00
R5936:Rictor UTSW 15 6,813,642 (GRCm39) missense probably damaging 0.99
R6155:Rictor UTSW 15 6,823,458 (GRCm39) missense probably benign 0.44
R6394:Rictor UTSW 15 6,798,790 (GRCm39) missense possibly damaging 0.59
R6549:Rictor UTSW 15 6,825,656 (GRCm39) missense probably damaging 1.00
R6611:Rictor UTSW 15 6,780,140 (GRCm39) missense probably damaging 1.00
R6657:Rictor UTSW 15 6,788,977 (GRCm39) missense possibly damaging 0.94
R6705:Rictor UTSW 15 6,823,493 (GRCm39) missense probably benign 0.00
R6819:Rictor UTSW 15 6,825,517 (GRCm39) critical splice donor site probably null
R6985:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R6989:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7016:Rictor UTSW 15 6,804,361 (GRCm39) critical splice donor site probably null
R7030:Rictor UTSW 15 6,737,934 (GRCm39) critical splice donor site probably null
R7066:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7067:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7216:Rictor UTSW 15 6,798,782 (GRCm39) missense probably damaging 1.00
R7396:Rictor UTSW 15 6,816,462 (GRCm39) missense not run
R7449:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7450:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7452:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7616:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7620:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7643:Rictor UTSW 15 6,798,750 (GRCm39) nonsense probably null
R7699:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7700:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7749:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7750:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7751:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7753:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7841:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7894:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7897:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7898:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R7944:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R8062:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R8063:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R8094:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R8119:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R8134:Rictor UTSW 15 6,801,635 (GRCm39) missense probably benign 0.27
R8166:Rictor UTSW 15 6,798,815 (GRCm39) critical splice donor site probably null
R8324:Rictor UTSW 15 6,775,043 (GRCm39) missense probably damaging 1.00
R8343:Rictor UTSW 15 6,807,800 (GRCm39) critical splice donor site probably null
R8691:Rictor UTSW 15 6,816,513 (GRCm39) missense probably damaging 1.00
R8859:Rictor UTSW 15 6,813,067 (GRCm39) missense probably damaging 0.98
R8953:Rictor UTSW 15 6,823,928 (GRCm39) missense probably benign 0.39
R8977:Rictor UTSW 15 6,812,566 (GRCm39) missense probably benign
R9008:Rictor UTSW 15 6,801,610 (GRCm39) splice site probably benign
R9369:Rictor UTSW 15 6,773,848 (GRCm39) missense probably benign 0.00
R9563:Rictor UTSW 15 6,797,562 (GRCm39) missense possibly damaging 0.83
R9695:Rictor UTSW 15 6,816,010 (GRCm39) missense probably benign 0.00
X0020:Rictor UTSW 15 6,785,963 (GRCm39) missense probably benign 0.32
X0060:Rictor UTSW 15 6,816,033 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATTGGCAACTTTTAGAAGCCA -3'
(R):5'- AGAATTGTAACTTCCCCTTCTTGG -3'

Sequencing Primer
(F):5'- CCATGTAGATCCTGGGATAGAACTC -3'
(R):5'- ACACAACCTATCAACTCCTTGTTTTC -3'
Posted On 2020-09-15