Incidental Mutation 'R7938:Morn5'
ID648845
Institutional Source Beutler Lab
Gene Symbol Morn5
Ensembl Gene ENSMUSG00000026894
Gene NameMORN repeat containing 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7938 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location36049458-36079718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36057070 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 120 (Y120F)
Ref Sequence ENSEMBL: ENSMUSP00000028256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028256]
Predicted Effect probably benign
Transcript: ENSMUST00000028256
AA Change: Y120F

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000028256
Gene: ENSMUSG00000026894
AA Change: Y120F

DomainStartEndE-ValueType
MORN 6 27 1.24e1 SMART
MORN 29 50 3.61e-2 SMART
Pfam:MORN 54 75 2e-4 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,164,885 K393E possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Bcam T G 7: 19,756,813 E586D probably benign Het
Bmp7 A C 2: 172,879,490 I264S probably benign Het
Casz1 G A 4: 148,944,486 M1129I probably benign Het
Ccdc59 T A 10: 105,841,594 N31K probably benign Het
Cfap61 A G 2: 146,045,456 Y607C probably benign Het
Cnga1 T C 5: 72,604,254 E639G probably benign Het
Coch T A 12: 51,596,583 probably null Het
Col6a6 A C 9: 105,780,684 Y776* probably null Het
Cyp1a1 T G 9: 57,701,790 L318R probably damaging Het
Cyp3a16 T A 5: 145,452,856 Y233F probably benign Het
Dgkz G T 2: 91,965,472 R42S probably damaging Het
Dner A G 1: 84,695,497 Y78H possibly damaging Het
Fam205a1 A G 4: 42,850,765 S464P possibly damaging Het
Fat2 T C 11: 55,273,096 N3111S probably damaging Het
Frmpd2 T C 14: 33,538,289 S768P probably benign Het
Gm45861 T A 8: 27,581,962 N1269K unknown Het
Gpr12 T A 5: 146,583,284 Y276F possibly damaging Het
Hace1 C T 10: 45,686,696 P769L probably benign Het
Hapln1 G A 13: 89,605,228 R171H probably damaging Het
Hlx T G 1: 184,731,928 T72P probably benign Het
Iqcm G T 8: 75,577,968 C119F probably benign Het
Katna1 G T 10: 7,761,311 A409S probably benign Het
Kcnip2 A T 19: 45,794,290 I204N probably damaging Het
Kel G T 6: 41,698,376 Q314K probably benign Het
Klf5 T C 14: 99,299,008 V5A probably damaging Het
Lax1 A T 1: 133,680,158 C282S probably benign Het
Lyar A G 5: 38,230,951 T274A probably benign Het
Mboat1 A G 13: 30,231,976 H306R possibly damaging Het
Mrgprx2 T C 7: 48,482,492 T193A probably benign Het
Myh10 T A 11: 68,692,501 W8R unknown Het
Nfasc A G 1: 132,605,531 V644A probably damaging Het
Nup153 G T 13: 46,689,379 probably null Het
Olfr1269 A T 2: 90,118,829 Y256* probably null Het
Olfr187 A T 16: 59,035,962 Y258* probably null Het
Olfr99 T A 17: 37,280,100 M107L probably benign Het
Orc4 A T 2: 48,910,191 V315E possibly damaging Het
Pcsk5 T A 19: 17,466,185 probably null Het
Pif1 A G 9: 65,594,791 D635G probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppfia2 A G 10: 106,474,787 T52A probably damaging Het
Ppp1r36 A T 12: 76,438,406 D301V probably damaging Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Qser1 A C 2: 104,788,967 V410G probably damaging Het
Reln A C 5: 21,950,872 N2207K probably damaging Het
Rimkla A G 4: 119,470,613 V180A probably benign Het
Rpa1 CA C 11: 75,307,224 probably null Het
Rsph3a G T 17: 7,946,218 E137* probably null Het
Sqle C A 15: 59,324,466 H369Q probably damaging Het
Srebf2 T A 15: 82,172,815 D250E probably damaging Het
Svs3b A T 2: 164,255,647 C251* probably null Het
Tdrd9 A T 12: 112,031,215 N713Y possibly damaging Het
Terf2ip T C 8: 112,012,085 S202P possibly damaging Het
Trank1 A G 9: 111,365,028 T707A probably benign Het
Trav8-1 T G 14: 53,470,231 D109E possibly damaging Het
Trem2 T A 17: 48,351,749 S181T probably benign Het
Trim37 A G 11: 87,147,037 N199S probably benign Het
Tshz3 T C 7: 36,769,158 F191L probably damaging Het
Ubxn8 A G 8: 33,621,684 M227T probably damaging Het
Uggt2 T A 14: 119,059,107 I448F possibly damaging Het
Usp47 T A 7: 112,087,925 L697M probably damaging Het
Vmn2r52 T C 7: 10,159,373 D613G probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Zfp423 T C 8: 87,895,676 Y11C unknown Het
Zw10 T A 9: 49,071,633 D521E probably benign Het
Other mutations in Morn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02158:Morn5 APN 2 36057076 missense probably damaging 1.00
IGL02190:Morn5 APN 2 36079515 missense probably benign 0.03
IGL02441:Morn5 APN 2 36055026 nonsense probably null
IGL02899:Morn5 APN 2 36055037 missense probably damaging 1.00
R0306:Morn5 UTSW 2 36054974 missense probably damaging 1.00
R1449:Morn5 UTSW 2 36057080 nonsense probably null
R1803:Morn5 UTSW 2 36053077 missense probably benign 0.03
R1819:Morn5 UTSW 2 36052975 missense probably damaging 1.00
R2012:Morn5 UTSW 2 36052938 missense probably benign 0.03
R3932:Morn5 UTSW 2 36053023 missense probably damaging 0.99
R7078:Morn5 UTSW 2 36054978 missense probably benign
R7681:Morn5 UTSW 2 36057144 missense possibly damaging 0.95
R8438:Morn5 UTSW 2 36055064 missense probably benign 0.03
R8805:Morn5 UTSW 2 36079521 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGCAAAAGGAGCATTTGGTC -3'
(R):5'- GGCTTACCAGCTTTGAATTCTGG -3'

Sequencing Primer
(F):5'- AGCATTTGGTCCCACAGTG -3'
(R):5'- CCAGCTTTGAATTCTGGAGACATCAG -3'
Posted On2020-09-15