Incidental Mutation 'R7938:Orc4'
ID648846
Institutional Source Beutler Lab
Gene Symbol Orc4
Ensembl Gene ENSMUSG00000026761
Gene Nameorigin recognition complex, subunit 4
SynonymsmMmORC4, Orc4, Orc4l, Orc4P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R7938 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location48902824-48950277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48910191 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 315 (V315E)
Ref Sequence ENSEMBL: ENSMUSP00000028098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028098]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028098
AA Change: V315E

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028098
Gene: ENSMUSG00000026761
AA Change: V315E

DomainStartEndE-ValueType
AAA 57 199 2.75e-5 SMART
Pfam:ORC4_C 225 413 1.3e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. This gene encodes a subunit of the ORC complex. Several alternatively spliced transcript variants, some of which encode the same protein, have been reported for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,164,885 K393E possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Bcam T G 7: 19,756,813 E586D probably benign Het
Bmp7 A C 2: 172,879,490 I264S probably benign Het
Casz1 G A 4: 148,944,486 M1129I probably benign Het
Ccdc59 T A 10: 105,841,594 N31K probably benign Het
Cfap61 A G 2: 146,045,456 Y607C probably benign Het
Cnga1 T C 5: 72,604,254 E639G probably benign Het
Col6a6 A C 9: 105,780,684 Y776* probably null Het
Cyp1a1 T G 9: 57,701,790 L318R probably damaging Het
Cyp3a16 T A 5: 145,452,856 Y233F probably benign Het
Dner A G 1: 84,695,497 Y78H possibly damaging Het
Fam205a1 A G 4: 42,850,765 S464P possibly damaging Het
Fat2 T C 11: 55,273,096 N3111S probably damaging Het
Frmpd2 T C 14: 33,538,289 S768P probably benign Het
Gm45861 T A 8: 27,581,962 N1269K unknown Het
Gpr12 T A 5: 146,583,284 Y276F possibly damaging Het
Hace1 C T 10: 45,686,696 P769L probably benign Het
Hapln1 G A 13: 89,605,228 R171H probably damaging Het
Hlx T G 1: 184,731,928 T72P probably benign Het
Iqcm G T 8: 75,577,968 C119F probably benign Het
Katna1 G T 10: 7,761,311 A409S probably benign Het
Kcnip2 A T 19: 45,794,290 I204N probably damaging Het
Kel G T 6: 41,698,376 Q314K probably benign Het
Klf5 T C 14: 99,299,008 V5A probably damaging Het
Lax1 A T 1: 133,680,158 C282S probably benign Het
Lyar A G 5: 38,230,951 T274A probably benign Het
Mboat1 A G 13: 30,231,976 H306R possibly damaging Het
Morn5 A T 2: 36,057,070 Y120F probably benign Het
Mrgprx2 T C 7: 48,482,492 T193A probably benign Het
Myh10 T A 11: 68,692,501 W8R unknown Het
Nfasc A G 1: 132,605,531 V644A probably damaging Het
Olfr1269 A T 2: 90,118,829 Y256* probably null Het
Olfr187 A T 16: 59,035,962 Y258* probably null Het
Olfr99 T A 17: 37,280,100 M107L probably benign Het
Pcsk5 T A 19: 17,466,185 probably null Het
Pif1 A G 9: 65,594,791 D635G probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppfia2 A G 10: 106,474,787 T52A probably damaging Het
Ppp1r36 A T 12: 76,438,406 D301V probably damaging Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Qser1 A C 2: 104,788,967 V410G probably damaging Het
Reln A C 5: 21,950,872 N2207K probably damaging Het
Rimkla A G 4: 119,470,613 V180A probably benign Het
Rpa1 CA C 11: 75,307,224 probably null Het
Rsph3a G T 17: 7,946,218 E137* probably null Het
Sqle C A 15: 59,324,466 H369Q probably damaging Het
Srebf2 T A 15: 82,172,815 D250E probably damaging Het
Svs3b A T 2: 164,255,647 C251* probably null Het
Tdrd9 A T 12: 112,031,215 N713Y possibly damaging Het
Terf2ip T C 8: 112,012,085 S202P possibly damaging Het
Trank1 A G 9: 111,365,028 T707A probably benign Het
Trav8-1 T G 14: 53,470,231 D109E possibly damaging Het
Trem2 T A 17: 48,351,749 S181T probably benign Het
Trim37 A G 11: 87,147,037 N199S probably benign Het
Tshz3 T C 7: 36,769,158 F191L probably damaging Het
Ubxn8 A G 8: 33,621,684 M227T probably damaging Het
Uggt2 T A 14: 119,059,107 I448F possibly damaging Het
Usp47 T A 7: 112,087,925 L697M probably damaging Het
Vmn2r52 T C 7: 10,159,373 D613G probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Zfp423 T C 8: 87,895,676 Y11C unknown Het
Zw10 T A 9: 49,071,633 D521E probably benign Het
Other mutations in Orc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Orc4 APN 2 48910269 missense probably benign
IGL01523:Orc4 APN 2 48917224 missense probably benign 0.00
IGL02546:Orc4 APN 2 48917284 missense probably null 0.02
IGL02592:Orc4 APN 2 48933078 critical splice donor site probably null
R0277:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0323:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0554:Orc4 UTSW 2 48905421 missense probably benign 0.01
R0573:Orc4 UTSW 2 48917273 missense probably benign 0.05
R0788:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0893:Orc4 UTSW 2 48932610 unclassified probably benign
R1112:Orc4 UTSW 2 48933572 missense probably damaging 0.97
R1466:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1466:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1584:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1868:Orc4 UTSW 2 48910293 missense probably benign 0.07
R2342:Orc4 UTSW 2 48927140 missense probably damaging 0.99
R2370:Orc4 UTSW 2 48933099 missense probably benign 0.01
R3085:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3086:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3122:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3404:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3551:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4199:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4515:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4518:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4519:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4521:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4523:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4529:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4532:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4533:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4652:Orc4 UTSW 2 48936750 unclassified probably benign
R4845:Orc4 UTSW 2 48909466 missense probably benign 0.07
R5893:Orc4 UTSW 2 48905547 nonsense probably null
R6708:Orc4 UTSW 2 48937493 missense probably benign 0.00
R6972:Orc4 UTSW 2 48927184 missense probably benign 0.03
R7572:Orc4 UTSW 2 48910236 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGGTATGGGATGCAGAACAC -3'
(R):5'- CAGCATCTGAACTAAGTCATTGCTAC -3'

Sequencing Primer
(F):5'- TATGGGATGCAGAACACAAAGAG -3'
(R):5'- CATTTTCATGGAGCAAAGTTTAAGG -3'
Posted On2020-09-15