Incidental Mutation 'R7938:Kel'
ID648861
Institutional Source Beutler Lab
Gene Symbol Kel
Ensembl Gene ENSMUSG00000029866
Gene NameKell blood group
SynonymsCD238
MMRRC Submission
Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7938 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location41686330-41704339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 41698376 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 314 (Q314K)
Ref Sequence ENSEMBL: ENSMUSP00000031899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031899]
Predicted Effect probably benign
Transcript: ENSMUST00000031899
AA Change: Q314K

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: Q314K

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Peptidase_M13_N 81 463 1.5e-68 PFAM
Pfam:Peptidase_M13 521 712 2.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192118
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,164,885 K393E possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Bcam T G 7: 19,756,813 E586D probably benign Het
Bmp7 A C 2: 172,879,490 I264S probably benign Het
Casz1 G A 4: 148,944,486 M1129I probably benign Het
Ccdc59 T A 10: 105,841,594 N31K probably benign Het
Cfap61 A G 2: 146,045,456 Y607C probably benign Het
Cnga1 T C 5: 72,604,254 E639G probably benign Het
Coch T A 12: 51,596,583 probably null Het
Col6a6 A C 9: 105,780,684 Y776* probably null Het
Cyp1a1 T G 9: 57,701,790 L318R probably damaging Het
Cyp3a16 T A 5: 145,452,856 Y233F probably benign Het
Dgkz G T 2: 91,965,472 R42S probably damaging Het
Dner A G 1: 84,695,497 Y78H possibly damaging Het
Fam205a1 A G 4: 42,850,765 S464P possibly damaging Het
Fat2 T C 11: 55,273,096 N3111S probably damaging Het
Frmpd2 T C 14: 33,538,289 S768P probably benign Het
Gm45861 T A 8: 27,581,962 N1269K unknown Het
Gpr12 T A 5: 146,583,284 Y276F possibly damaging Het
Hace1 C T 10: 45,686,696 P769L probably benign Het
Hapln1 G A 13: 89,605,228 R171H probably damaging Het
Hlx T G 1: 184,731,928 T72P probably benign Het
Iqcm G T 8: 75,577,968 C119F probably benign Het
Katna1 G T 10: 7,761,311 A409S probably benign Het
Kcnip2 A T 19: 45,794,290 I204N probably damaging Het
Klf5 T C 14: 99,299,008 V5A probably damaging Het
Lax1 A T 1: 133,680,158 C282S probably benign Het
Lyar A G 5: 38,230,951 T274A probably benign Het
Mboat1 A G 13: 30,231,976 H306R possibly damaging Het
Morn5 A T 2: 36,057,070 Y120F probably benign Het
Mrgprx2 T C 7: 48,482,492 T193A probably benign Het
Myh10 T A 11: 68,692,501 W8R unknown Het
Nfasc A G 1: 132,605,531 V644A probably damaging Het
Nup153 G T 13: 46,689,379 probably null Het
Olfr1269 A T 2: 90,118,829 Y256* probably null Het
Olfr187 A T 16: 59,035,962 Y258* probably null Het
Olfr99 T A 17: 37,280,100 M107L probably benign Het
Orc4 A T 2: 48,910,191 V315E possibly damaging Het
Pcsk5 T A 19: 17,466,185 probably null Het
Pif1 A G 9: 65,594,791 D635G probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppfia2 A G 10: 106,474,787 T52A probably damaging Het
Ppp1r36 A T 12: 76,438,406 D301V probably damaging Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Qser1 A C 2: 104,788,967 V410G probably damaging Het
Reln A C 5: 21,950,872 N2207K probably damaging Het
Rimkla A G 4: 119,470,613 V180A probably benign Het
Rpa1 CA C 11: 75,307,224 probably null Het
Rsph3a G T 17: 7,946,218 E137* probably null Het
Sqle C A 15: 59,324,466 H369Q probably damaging Het
Srebf2 T A 15: 82,172,815 D250E probably damaging Het
Svs3b A T 2: 164,255,647 C251* probably null Het
Tdrd9 A T 12: 112,031,215 N713Y possibly damaging Het
Terf2ip T C 8: 112,012,085 S202P possibly damaging Het
Trank1 A G 9: 111,365,028 T707A probably benign Het
Trav8-1 T G 14: 53,470,231 D109E possibly damaging Het
Trem2 T A 17: 48,351,749 S181T probably benign Het
Trim37 A G 11: 87,147,037 N199S probably benign Het
Tshz3 T C 7: 36,769,158 F191L probably damaging Het
Ubxn8 A G 8: 33,621,684 M227T probably damaging Het
Uggt2 T A 14: 119,059,107 I448F possibly damaging Het
Usp47 T A 7: 112,087,925 L697M probably damaging Het
Vmn2r52 T C 7: 10,159,373 D613G probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Zfp423 T C 8: 87,895,676 Y11C unknown Het
Zw10 T A 9: 49,071,633 D521E probably benign Het
Other mutations in Kel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Kel APN 6 41688575 missense probably damaging 1.00
IGL00792:Kel APN 6 41702012 missense probably damaging 1.00
IGL00972:Kel APN 6 41688066 missense possibly damaging 0.62
IGL01121:Kel APN 6 41702409 missense probably benign 0.00
IGL01286:Kel APN 6 41688117 splice site probably null
IGL01461:Kel APN 6 41701911 critical splice donor site probably null
IGL01836:Kel APN 6 41697438 missense possibly damaging 0.50
IGL02037:Kel APN 6 41697474 missense probably benign 0.01
IGL02103:Kel APN 6 41702389 missense probably benign 0.18
IGL02604:Kel APN 6 41687582 missense probably damaging 0.98
IGL03102:Kel APN 6 41702983 missense probably benign 0.00
IGL03274:Kel APN 6 41687995 splice site probably null
IGL03355:Kel APN 6 41698887 critical splice donor site probably null
A4554:Kel UTSW 6 41697419 missense possibly damaging 0.95
R0121:Kel UTSW 6 41702064 unclassified probably benign
R0153:Kel UTSW 6 41701943 missense probably benign 0.08
R0535:Kel UTSW 6 41690838 missense probably null 0.21
R0658:Kel UTSW 6 41703031 missense probably damaging 1.00
R1005:Kel UTSW 6 41688617 missense probably damaging 1.00
R1199:Kel UTSW 6 41688591 missense possibly damaging 0.95
R1272:Kel UTSW 6 41703470 missense probably benign 0.00
R1531:Kel UTSW 6 41688626 missense probably damaging 0.99
R1880:Kel UTSW 6 41687545 missense possibly damaging 0.95
R2102:Kel UTSW 6 41686484 missense possibly damaging 0.86
R2118:Kel UTSW 6 41689300 missense probably benign
R2571:Kel UTSW 6 41688067 missense possibly damaging 0.62
R4209:Kel UTSW 6 41698425 nonsense probably null
R4210:Kel UTSW 6 41698425 nonsense probably null
R4260:Kel UTSW 6 41686423 utr 3 prime probably benign
R4382:Kel UTSW 6 41698400 missense probably benign 0.13
R5023:Kel UTSW 6 41688111 missense probably damaging 1.00
R5033:Kel UTSW 6 41699055 missense probably damaging 1.00
R5239:Kel UTSW 6 41688114 nonsense probably null
R5431:Kel UTSW 6 41698420 missense probably benign 0.23
R5742:Kel UTSW 6 41699027 missense probably damaging 1.00
R5745:Kel UTSW 6 41699027 missense probably damaging 1.00
R5746:Kel UTSW 6 41699027 missense probably damaging 1.00
R5978:Kel UTSW 6 41688045 missense probably benign 0.00
R6023:Kel UTSW 6 41697475 missense probably benign
R6109:Kel UTSW 6 41688862 missense probably benign 0.06
R6125:Kel UTSW 6 41690786 missense probably damaging 1.00
R6319:Kel UTSW 6 41702447 missense probably benign 0.05
R6368:Kel UTSW 6 41688851 nonsense probably null
R6864:Kel UTSW 6 41703760 critical splice donor site probably null
R6956:Kel UTSW 6 41687973 missense probably damaging 1.00
R7644:Kel UTSW 6 41690808 missense probably benign 0.03
R8028:Kel UTSW 6 41699024 missense probably benign 0.21
R8082:Kel UTSW 6 41703490 missense possibly damaging 0.94
R8465:Kel UTSW 6 41689538 critical splice donor site probably null
X0028:Kel UTSW 6 41698351 missense probably damaging 0.99
Z1176:Kel UTSW 6 41687572 missense probably damaging 1.00
Z1177:Kel UTSW 6 41689559 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCATGTCACAGGTGCCTTC -3'
(R):5'- TGGGACTTTAGGCAGAAATGTG -3'

Sequencing Primer
(F):5'- ACAGGTGCCTTCCACTCACG -3'
(R):5'- GCCTTCTACCATATAGGCTAGGAG -3'
Posted On2020-09-15