Mutagenetix > Incidental Mutation

Incidental Mutation 'R7938:Kel'

648861

Institutional Source

Beutler Lab

Gene Symbol

Kel

Ensembl Gene

ENSMUSG00000029866

Gene Name

Kell blood group

Synonyms

CD238

MMRRC Submission

Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R7938 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

41686330-41704339 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 41698376 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 314 (Q314K)

Ref Sequence

ENSEMBL: ENSMUSP00000031899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031899]

AlphaFold

Q9EQF2

Predicted Effect

probably benign
Transcript: ENSMUST00000031899
AA Change: Q314K

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: Q314K

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
Pfam:Peptidase_M13_N	81	463	1.5e-68	PFAM
Pfam:Peptidase_M13	521	712	2.1e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000192118

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	T	C	6: 96,164,885	K393E	possibly damaging	Het
Ampd2	C	A	3: 108,080,116	V134L	probably benign	Het
Bcam	T	G	7: 19,756,813	E586D	probably benign	Het
Bmp7	A	C	2: 172,879,490	I264S	probably benign	Het
Casz1	G	A	4: 148,944,486	M1129I	probably benign	Het
Ccdc59	T	A	10: 105,841,594	N31K	probably benign	Het
Cfap61	A	G	2: 146,045,456	Y607C	probably benign	Het
Cnga1	T	C	5: 72,604,254	E639G	probably benign	Het
Coch	T	A	12: 51,596,583		probably null	Het
Col6a6	A	C	9: 105,780,684	Y776*	probably null	Het
Cyp1a1	T	G	9: 57,701,790	L318R	probably damaging	Het
Cyp3a16	T	A	5: 145,452,856	Y233F	probably benign	Het
Dgkz	G	T	2: 91,965,472	R42S	probably damaging	Het
Dner	A	G	1: 84,695,497	Y78H	possibly damaging	Het
Fam205a1	A	G	4: 42,850,765	S464P	possibly damaging	Het
Fat2	T	C	11: 55,273,096	N3111S	probably damaging	Het
Frmpd2	T	C	14: 33,538,289	S768P	probably benign	Het
Gm45861	T	A	8: 27,581,962	N1269K	unknown	Het
Gpr12	T	A	5: 146,583,284	Y276F	possibly damaging	Het
Hace1	C	T	10: 45,686,696	P769L	probably benign	Het
Hapln1	G	A	13: 89,605,228	R171H	probably damaging	Het
Hlx	T	G	1: 184,731,928	T72P	probably benign	Het
Iqcm	G	T	8: 75,577,968	C119F	probably benign	Het
Katna1	G	T	10: 7,761,311	A409S	probably benign	Het
Kcnip2	A	T	19: 45,794,290	I204N	probably damaging	Het
Klf5	T	C	14: 99,299,008	V5A	probably damaging	Het
Lax1	A	T	1: 133,680,158	C282S	probably benign	Het
Lyar	A	G	5: 38,230,951	T274A	probably benign	Het
Mboat1	A	G	13: 30,231,976	H306R	possibly damaging	Het
Morn5	A	T	2: 36,057,070	Y120F	probably benign	Het
Mrgprx2	T	C	7: 48,482,492	T193A	probably benign	Het
Myh10	T	A	11: 68,692,501	W8R	unknown	Het
Nfasc	A	G	1: 132,605,531	V644A	probably damaging	Het
Nup153	G	T	13: 46,689,379		probably null	Het
Olfr1269	A	T	2: 90,118,829	Y256*	probably null	Het
Olfr187	A	T	16: 59,035,962	Y258*	probably null	Het
Olfr99	T	A	17: 37,280,100	M107L	probably benign	Het
Orc4	A	T	2: 48,910,191	V315E	possibly damaging	Het
Pcsk5	T	A	19: 17,466,185		probably null	Het
Pif1	A	G	9: 65,594,791	D635G	probably benign	Het
Plscr4	C	T	9: 92,490,790	R322*	probably null	Het
Ppfia2	A	G	10: 106,474,787	T52A	probably damaging	Het
Ppp1r36	A	T	12: 76,438,406	D301V	probably damaging	Het
Prss46	A	G	9: 110,851,432	N215S	probably benign	Het
Qser1	A	C	2: 104,788,967	V410G	probably damaging	Het
Reln	A	C	5: 21,950,872	N2207K	probably damaging	Het
Rimkla	A	G	4: 119,470,613	V180A	probably benign	Het
Rpa1	CA	C	11: 75,307,224		probably null	Het
Rsph3a	G	T	17: 7,946,218	E137*	probably null	Het
Sqle	C	A	15: 59,324,466	H369Q	probably damaging	Het
Srebf2	T	A	15: 82,172,815	D250E	probably damaging	Het
Svs3b	A	T	2: 164,255,647	C251*	probably null	Het
Tdrd9	A	T	12: 112,031,215	N713Y	possibly damaging	Het
Terf2ip	T	C	8: 112,012,085	S202P	possibly damaging	Het
Trank1	A	G	9: 111,365,028	T707A	probably benign	Het
Trav8-1	T	G	14: 53,470,231	D109E	possibly damaging	Het
Trem2	T	A	17: 48,351,749	S181T	probably benign	Het
Trim37	A	G	11: 87,147,037	N199S	probably benign	Het
Tshz3	T	C	7: 36,769,158	F191L	probably damaging	Het
Ubxn8	A	G	8: 33,621,684	M227T	probably damaging	Het
Uggt2	T	A	14: 119,059,107	I448F	possibly damaging	Het
Usp47	T	A	7: 112,087,925	L697M	probably damaging	Het
Vmn2r52	T	C	7: 10,159,373	D613G	probably benign	Het
Wdr81	T	C	11: 75,448,002	T1444A	probably benign	Het
Zfp423	T	C	8: 87,895,676	Y11C	unknown	Het
Zw10	T	A	9: 49,071,633	D521E	probably benign	Het

Other mutations in Kel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Kel	APN	6	41688575	missense	probably damaging	1.00
IGL00792:Kel	APN	6	41702012	missense	probably damaging	1.00
IGL00972:Kel	APN	6	41688066	missense	possibly damaging	0.62
IGL01121:Kel	APN	6	41702409	missense	probably benign	0.00
IGL01286:Kel	APN	6	41688117	splice site	probably null
IGL01461:Kel	APN	6	41701911	critical splice donor site	probably null
IGL01836:Kel	APN	6	41697438	missense	possibly damaging	0.50
IGL02037:Kel	APN	6	41697474	missense	probably benign	0.01
IGL02103:Kel	APN	6	41702389	missense	probably benign	0.18
IGL02604:Kel	APN	6	41687582	missense	probably damaging	0.98
IGL03102:Kel	APN	6	41702983	missense	probably benign	0.00
IGL03274:Kel	APN	6	41687995	splice site	probably null
IGL03355:Kel	APN	6	41698887	critical splice donor site	probably null
A4554:Kel	UTSW	6	41697419	missense	possibly damaging	0.95
R0121:Kel	UTSW	6	41702064	unclassified	probably benign
R0153:Kel	UTSW	6	41701943	missense	probably benign	0.08
R0535:Kel	UTSW	6	41690838	missense	probably null	0.21
R0658:Kel	UTSW	6	41703031	missense	probably damaging	1.00
R1005:Kel	UTSW	6	41688617	missense	probably damaging	1.00
R1199:Kel	UTSW	6	41688591	missense	possibly damaging	0.95
R1272:Kel	UTSW	6	41703470	missense	probably benign	0.00
R1531:Kel	UTSW	6	41688626	missense	probably damaging	0.99
R1880:Kel	UTSW	6	41687545	missense	possibly damaging	0.95
R2102:Kel	UTSW	6	41686484	missense	possibly damaging	0.86
R2118:Kel	UTSW	6	41689300	missense	probably benign
R2571:Kel	UTSW	6	41688067	missense	possibly damaging	0.62
R4209:Kel	UTSW	6	41698425	nonsense	probably null
R4210:Kel	UTSW	6	41698425	nonsense	probably null
R4260:Kel	UTSW	6	41686423	utr 3 prime	probably benign
R4382:Kel	UTSW	6	41698400	missense	probably benign	0.13
R5023:Kel	UTSW	6	41688111	missense	probably damaging	1.00
R5033:Kel	UTSW	6	41699055	missense	probably damaging	1.00
R5239:Kel	UTSW	6	41688114	nonsense	probably null
R5431:Kel	UTSW	6	41698420	missense	probably benign	0.23
R5742:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5745:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5746:Kel	UTSW	6	41699027	missense	probably damaging	1.00
R5978:Kel	UTSW	6	41688045	missense	probably benign	0.00
R6023:Kel	UTSW	6	41697475	missense	probably benign
R6109:Kel	UTSW	6	41688862	missense	probably benign	0.06
R6125:Kel	UTSW	6	41690786	missense	probably damaging	1.00
R6319:Kel	UTSW	6	41702447	missense	probably benign	0.05
R6368:Kel	UTSW	6	41688851	nonsense	probably null
R6864:Kel	UTSW	6	41703760	critical splice donor site	probably null
R6956:Kel	UTSW	6	41687973	missense	probably damaging	1.00
R7644:Kel	UTSW	6	41690808	missense	probably benign	0.03
R8028:Kel	UTSW	6	41699024	missense	probably benign	0.21
R8082:Kel	UTSW	6	41703490	missense	possibly damaging	0.94
R8465:Kel	UTSW	6	41689538	critical splice donor site	probably null
R9158:Kel	UTSW	6	41687971	missense	probably benign	0.10
R9518:Kel	UTSW	6	41702400	missense	probably damaging	1.00
X0028:Kel	UTSW	6	41698351	missense	probably damaging	0.99
Z1176:Kel	UTSW	6	41687572	missense	probably damaging	1.00
Z1177:Kel	UTSW	6	41689559	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCATGTCACAGGTGCCTTC -3'
(R):5'- TGGGACTTTAGGCAGAAATGTG -3'

Sequencing Primer
(F):5'- ACAGGTGCCTTCCACTCACG -3'
(R):5'- GCCTTCTACCATATAGGCTAGGAG -3'

Posted On

2020-09-15