Incidental Mutation 'R7938:Myh10'
ID648885
Institutional Source Beutler Lab
Gene Symbol Myh10
Ensembl Gene ENSMUSG00000020900
Gene Namemyosin, heavy polypeptide 10, non-muscle
SynonymsMyosin IIB, Fltn, Fltn, Myhn-2, myosin IIB, nonmuscle myosin heavy chain II-B, NMHC-B, Myhn2, SMemb, NMHC II-B, 5730504C04Rik, nonmuscle myosin heavy chain IIB, 9330167F11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7938 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location68691559-68816632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68692501 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 8 (W8R)
Ref Sequence ENSEMBL: ENSMUSP00000090661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018887] [ENSMUST00000092984] [ENSMUST00000102611] [ENSMUST00000108673]
Predicted Effect probably benign
Transcript: ENSMUST00000018887
SMART Domains Protein: ENSMUSP00000018887
Gene: ENSMUSG00000020900

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.5e-15 PFAM
MYSc 79 815 N/A SMART
IQ 816 838 4.81e-4 SMART
low complexity region 932 946 N/A INTRINSIC
low complexity region 984 994 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1070 1086 N/A INTRINSIC
Pfam:Myosin_tail_1 1104 1961 6.5e-211 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000092984
AA Change: W8R
SMART Domains Protein: ENSMUSP00000090661
Gene: ENSMUSG00000020900
AA Change: W8R

DomainStartEndE-ValueType
Pfam:Myosin_N 70 110 2.5e-13 PFAM
MYSc 116 821 N/A SMART
IQ 822 844 4.81e-4 SMART
Pfam:Myosin_tail_1 885 1965 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102611
SMART Domains Protein: ENSMUSP00000099671
Gene: ENSMUSG00000020900

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.4e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 4.81e-4 SMART
low complexity region 901 915 N/A INTRINSIC
low complexity region 953 963 N/A INTRINSIC
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1039 1055 N/A INTRINSIC
Pfam:Myosin_tail_1 1073 1930 6.2e-211 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108673
SMART Domains Protein: ENSMUSP00000104313
Gene: ENSMUSG00000020900

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 9.3e-17 PFAM
MYSc 79 231 2.25e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-10 (MYO10). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene have been associated with May-Hegglin anomaly and developmental defects in brain and heart. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Nullizygous mice show pre- and neonatal death, heart defects and hydrocephaly. Deletion of exon B1 disrupts migration of facial neurons, whereas deletion of exon B2 leads to Purkinje cell anomalies. Hypomorphs show hydrocephaly and defects in motor control, cerebellar foliation and neuron migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,164,885 K393E possibly damaging Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Bcam T G 7: 19,756,813 E586D probably benign Het
Bmp7 A C 2: 172,879,490 I264S probably benign Het
Casz1 G A 4: 148,944,486 M1129I probably benign Het
Ccdc59 T A 10: 105,841,594 N31K probably benign Het
Cfap61 A G 2: 146,045,456 Y607C probably benign Het
Cnga1 T C 5: 72,604,254 E639G probably benign Het
Col6a6 A C 9: 105,780,684 Y776* probably null Het
Cyp1a1 T G 9: 57,701,790 L318R probably damaging Het
Cyp3a16 T A 5: 145,452,856 Y233F probably benign Het
Dner A G 1: 84,695,497 Y78H possibly damaging Het
Fam205a1 A G 4: 42,850,765 S464P possibly damaging Het
Fat2 T C 11: 55,273,096 N3111S probably damaging Het
Frmpd2 T C 14: 33,538,289 S768P probably benign Het
Gm45861 T A 8: 27,581,962 N1269K unknown Het
Gpr12 T A 5: 146,583,284 Y276F possibly damaging Het
Hace1 C T 10: 45,686,696 P769L probably benign Het
Hapln1 G A 13: 89,605,228 R171H probably damaging Het
Hlx T G 1: 184,731,928 T72P probably benign Het
Iqcm G T 8: 75,577,968 C119F probably benign Het
Katna1 G T 10: 7,761,311 A409S probably benign Het
Kcnip2 A T 19: 45,794,290 I204N probably damaging Het
Kel G T 6: 41,698,376 Q314K probably benign Het
Klf5 T C 14: 99,299,008 V5A probably damaging Het
Lax1 A T 1: 133,680,158 C282S probably benign Het
Lyar A G 5: 38,230,951 T274A probably benign Het
Mboat1 A G 13: 30,231,976 H306R possibly damaging Het
Morn5 A T 2: 36,057,070 Y120F probably benign Het
Mrgprx2 T C 7: 48,482,492 T193A probably benign Het
Nfasc A G 1: 132,605,531 V644A probably damaging Het
Olfr1269 A T 2: 90,118,829 Y256* probably null Het
Olfr187 A T 16: 59,035,962 Y258* probably null Het
Olfr99 T A 17: 37,280,100 M107L probably benign Het
Orc4 A T 2: 48,910,191 V315E possibly damaging Het
Pcsk5 T A 19: 17,466,185 probably null Het
Pif1 A G 9: 65,594,791 D635G probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppfia2 A G 10: 106,474,787 T52A probably damaging Het
Ppp1r36 A T 12: 76,438,406 D301V probably damaging Het
Prss46 A G 9: 110,851,432 N215S probably benign Het
Qser1 A C 2: 104,788,967 V410G probably damaging Het
Reln A C 5: 21,950,872 N2207K probably damaging Het
Rimkla A G 4: 119,470,613 V180A probably benign Het
Rpa1 CA C 11: 75,307,224 probably null Het
Rsph3a G T 17: 7,946,218 E137* probably null Het
Sqle C A 15: 59,324,466 H369Q probably damaging Het
Srebf2 T A 15: 82,172,815 D250E probably damaging Het
Svs3b A T 2: 164,255,647 C251* probably null Het
Tdrd9 A T 12: 112,031,215 N713Y possibly damaging Het
Terf2ip T C 8: 112,012,085 S202P possibly damaging Het
Trank1 A G 9: 111,365,028 T707A probably benign Het
Trav8-1 T G 14: 53,470,231 D109E possibly damaging Het
Trem2 T A 17: 48,351,749 S181T probably benign Het
Trim37 A G 11: 87,147,037 N199S probably benign Het
Tshz3 T C 7: 36,769,158 F191L probably damaging Het
Ubxn8 A G 8: 33,621,684 M227T probably damaging Het
Uggt2 T A 14: 119,059,107 I448F possibly damaging Het
Usp47 T A 7: 112,087,925 L697M probably damaging Het
Vmn2r52 T C 7: 10,159,373 D613G probably benign Het
Wdr81 T C 11: 75,448,002 T1444A probably benign Het
Zfp423 T C 8: 87,895,676 Y11C unknown Het
Zw10 T A 9: 49,071,633 D521E probably benign Het
Other mutations in Myh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Myh10 APN 11 68790708 missense probably benign 0.10
IGL01132:Myh10 APN 11 68768268 missense possibly damaging 0.93
IGL01348:Myh10 APN 11 68811803 missense probably benign 0.04
IGL01404:Myh10 APN 11 68752040 splice site probably null
IGL01409:Myh10 APN 11 68807219 missense probably damaging 0.98
IGL01660:Myh10 APN 11 68785889 missense probably benign 0.00
IGL02111:Myh10 APN 11 68790112 missense probably damaging 1.00
IGL02481:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02483:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02502:Myh10 APN 11 68814372 splice site probably null
IGL03178:Myh10 APN 11 68699413 missense probably benign 0.19
algia UTSW 11 68802931 missense probably damaging 1.00
itis UTSW 11 68764245 missense probably damaging 0.96
PIT4802001:Myh10 UTSW 11 68765092 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0517:Myh10 UTSW 11 68811599 critical splice acceptor site probably null
R0855:Myh10 UTSW 11 68811801 missense possibly damaging 0.88
R1110:Myh10 UTSW 11 68791850 splice site probably benign
R1135:Myh10 UTSW 11 68807197 missense probably benign
R1169:Myh10 UTSW 11 68762841 missense probably damaging 0.99
R1643:Myh10 UTSW 11 68792010 missense probably damaging 0.96
R1733:Myh10 UTSW 11 68802296 missense probably benign 0.06
R1754:Myh10 UTSW 11 68813058 missense probably damaging 0.98
R1859:Myh10 UTSW 11 68745413 missense probably benign 0.03
R1898:Myh10 UTSW 11 68771906 missense probably damaging 1.00
R1905:Myh10 UTSW 11 68771868 splice site probably benign
R1914:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1915:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1987:Myh10 UTSW 11 68814496 missense possibly damaging 0.56
R2130:Myh10 UTSW 11 68807289 splice site probably benign
R2132:Myh10 UTSW 11 68807289 splice site probably benign
R2136:Myh10 UTSW 11 68804714 missense probably damaging 1.00
R2214:Myh10 UTSW 11 68783127 missense probably damaging 1.00
R2351:Myh10 UTSW 11 68793139 missense probably damaging 1.00
R3407:Myh10 UTSW 11 68790211 missense possibly damaging 0.68
R3721:Myh10 UTSW 11 68813052 missense probably damaging 0.99
R3908:Myh10 UTSW 11 68771059 critical splice donor site probably null
R4275:Myh10 UTSW 11 68751940 critical splice acceptor site probably null
R4526:Myh10 UTSW 11 68815049 missense probably benign 0.04
R4666:Myh10 UTSW 11 68801730 critical splice donor site probably null
R4668:Myh10 UTSW 11 68804642 missense probably damaging 1.00
R4750:Myh10 UTSW 11 68785314 missense probably damaging 1.00
R4968:Myh10 UTSW 11 68793223 missense probably damaging 1.00
R4977:Myh10 UTSW 11 68798371 missense possibly damaging 0.55
R5201:Myh10 UTSW 11 68783195 missense probably damaging 1.00
R5288:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5304:Myh10 UTSW 11 68764245 missense probably damaging 0.96
R5366:Myh10 UTSW 11 68760692 missense probably damaging 0.97
R5384:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5427:Myh10 UTSW 11 68802931 missense probably damaging 1.00
R5546:Myh10 UTSW 11 68798380 missense possibly damaging 0.90
R5551:Myh10 UTSW 11 68768287 missense possibly damaging 0.65
R5777:Myh10 UTSW 11 68785859 missense probably damaging 1.00
R5995:Myh10 UTSW 11 68814983 missense probably benign 0.01
R6021:Myh10 UTSW 11 68808862 missense possibly damaging 0.72
R6171:Myh10 UTSW 11 68791890 missense probably damaging 1.00
R6179:Myh10 UTSW 11 68802153 missense probably damaging 0.98
R6263:Myh10 UTSW 11 68810232 missense probably damaging 0.98
R6264:Myh10 UTSW 11 68745415 missense probably benign 0.01
R6484:Myh10 UTSW 11 68699467 missense probably damaging 1.00
R6575:Myh10 UTSW 11 68808850 missense probably benign 0.00
R6736:Myh10 UTSW 11 68745339 missense probably damaging 1.00
R7141:Myh10 UTSW 11 68802139 missense probably benign
R7256:Myh10 UTSW 11 68790689 missense probably damaging 1.00
R7329:Myh10 UTSW 11 68810191 missense probably benign 0.44
R7363:Myh10 UTSW 11 68815048 missense probably benign
R7576:Myh10 UTSW 11 68802166 missense probably damaging 1.00
R7577:Myh10 UTSW 11 68745980 missense unknown
R7681:Myh10 UTSW 11 68771936 missense probably damaging 0.98
R7813:Myh10 UTSW 11 68785909 missense probably benign 0.00
R7834:Myh10 UTSW 11 68785826 missense probably damaging 1.00
R7922:Myh10 UTSW 11 68808893 missense possibly damaging 0.56
R7958:Myh10 UTSW 11 68721347 missense probably benign 0.00
R7994:Myh10 UTSW 11 68790244 critical splice donor site probably null
R8395:Myh10 UTSW 11 68792016 missense probably damaging 0.98
X0028:Myh10 UTSW 11 68793135 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAATTGAGACGCTGGATC -3'
(R):5'- CCGGGGAAATCTAACTCCAC -3'

Sequencing Primer
(F):5'- CTTCGGCTGAAGGTGAGAC -3'
(R):5'- GGGGAAATCTAACTCCACCTAAC -3'
Posted On2020-09-15