Incidental Mutation 'R0015:Clrn1'
ID 64889
Institutional Source Beutler Lab
Gene Symbol Clrn1
Ensembl Gene ENSMUSG00000043850
Gene Name clarin 1
Synonyms Ush3a, A130002D11Rik, USH3, clarin-1
MMRRC Submission 038310-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0015 (G1)
Quality Score 114
Status Validated
Chromosome 3
Chromosomal Location 58844028-58885340 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58846427 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 171 (I171K)
Ref Sequence ENSEMBL: ENSMUSP00000052254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051408] [ENSMUST00000055636] [ENSMUST00000072551]
AlphaFold Q8K445
Predicted Effect possibly damaging
Transcript: ENSMUST00000051408
AA Change: I153K

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051738
Gene: ENSMUSG00000043850
AA Change: I153K

DomainStartEndE-ValueType
Pfam:Claudin_2 18 208 1.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000055636
AA Change: I171K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052254
Gene: ENSMUSG00000043850
AA Change: I171K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
transmembrane domain 207 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072551
AA Change: I93K

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000072363
Gene: ENSMUSG00000043850
AA Change: I93K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SCOP:d1hw7a_ 65 87 5e-3 SMART
transmembrane domain 129 151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161419
Meta Mutation Damage Score 0.1468 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a cytosolic N-terminus, multiple helical transmembrane domains, and an endoplasmic reticulum membrane retention signal, TKGH, in the C-terminus. The encoded protein may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIIa. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss and loss of balance associated with defects in outer hair cells and supporting cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,186,184 R408H probably damaging Het
A130050O07Rik A G 1: 137,928,656 Y23C unknown Het
Adcy3 G A 12: 4,195,260 probably null Het
Aldh6a1 G A 12: 84,441,780 L86F probably damaging Het
Arl10 G T 13: 54,575,957 probably benign Het
Armc3 A G 2: 19,296,321 probably null Het
Astn2 T G 4: 66,266,382 probably null Het
Cacna1d G A 14: 30,114,971 T804I probably benign Het
Ccny A C 18: 9,316,682 probably benign Het
Cdh5 C T 8: 104,140,927 T612I probably benign Het
Cfap58 A G 19: 48,029,100 M800V probably benign Het
Cnp T A 11: 100,578,908 probably null Het
Col12a1 T C 9: 79,651,385 T1933A probably damaging Het
Cwf19l2 A G 9: 3,454,666 S660G probably benign Het
Dync1i2 C A 2: 71,214,484 R13S probably damaging Het
Eps8l1 A T 7: 4,477,557 probably benign Het
Espn T C 4: 152,139,152 T188A possibly damaging Het
F2 T C 2: 91,630,607 E260G probably benign Het
Fat4 T A 3: 38,982,503 S3435T probably damaging Het
Fchsd1 A G 18: 37,962,959 C533R probably benign Het
Fstl5 G A 3: 76,322,191 V100M probably damaging Het
Gls2 T G 10: 128,209,350 L572R probably damaging Het
Gm20939 A T 17: 94,876,768 E281D probably benign Het
Gpr35 T G 1: 92,983,232 L222W probably damaging Het
Hsf5 C A 11: 87,657,335 H615N probably benign Het
Id2 C T 12: 25,095,803 D70N probably damaging Het
Ints2 T C 11: 86,249,287 T240A probably damaging Het
Kcnn3 A C 3: 89,662,773 D631A probably damaging Het
Klhdc8a A G 1: 132,303,005 T203A probably damaging Het
Lama4 C T 10: 39,075,436 T1059M possibly damaging Het
Lgals8 A G 13: 12,447,298 L226P probably damaging Het
Lifr T A 15: 7,188,186 probably null Het
Lonp1 T A 17: 56,618,406 Q462L probably benign Het
Lypd1 A G 1: 125,910,438 V48A possibly damaging Het
Mapkapk2 A G 1: 131,097,326 I67T possibly damaging Het
Mbd3l1 A T 9: 18,484,858 D93V probably benign Het
Mdh1b T C 1: 63,721,800 probably benign Het
Myh7b C T 2: 155,622,286 P569L probably damaging Het
Ncapd3 C A 9: 27,051,809 A470E probably damaging Het
Ndrg2 A G 14: 51,910,445 probably benign Het
Nprl2 A T 9: 107,544,419 I209F probably damaging Het
Ntrk1 A G 3: 87,791,750 probably benign Het
Olfm2 T C 9: 20,668,741 E268G probably damaging Het
Olfr884 T A 9: 38,047,667 Y148* probably null Het
Pcf11 T A 7: 92,658,317 H881L probably benign Het
Pde10a A G 17: 8,977,197 D640G probably damaging Het
Pde9a G A 17: 31,386,356 probably null Het
Pianp G T 6: 125,001,540 G236V probably damaging Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Ppp1r3a A G 6: 14,717,661 S1085P possibly damaging Het
Pter G A 2: 13,001,000 G328D probably damaging Het
Rad51 T A 2: 119,116,327 M5K probably benign Het
Rbm43 T A 2: 51,925,667 I181F probably benign Het
Rgs12 T C 5: 35,022,776 probably benign Het
Rnf213 A C 11: 119,441,606 D2547A possibly damaging Het
Slc20a2 C A 8: 22,535,345 A21E probably damaging Het
Stab2 A G 10: 86,843,617 S2503P probably benign Het
Sv2b A T 7: 75,125,641 F479L probably damaging Het
Sybu T C 15: 44,673,500 R349G probably damaging Het
Tead3 T C 17: 28,341,351 Y2C probably damaging Het
Tnrc6c T A 11: 117,721,458 N307K probably damaging Het
Ubxn11 C G 4: 134,116,025 probably null Het
Ust T C 10: 8,330,065 probably benign Het
Vmn2r116 T A 17: 23,401,849 N852K probably benign Het
Zgrf1 T C 3: 127,555,397 probably benign Het
Other mutations in Clrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Clrn1 APN 3 58885025 missense probably damaging 0.99
IGL03184:Clrn1 APN 3 58846224 missense probably benign 0.00
IGL03187:Clrn1 APN 3 58846433 missense probably damaging 0.99
R0015:Clrn1 UTSW 3 58846427 missense probably damaging 0.99
R1055:Clrn1 UTSW 3 58865110 missense probably benign 0.38
R2301:Clrn1 UTSW 3 58846352 missense probably damaging 1.00
R4753:Clrn1 UTSW 3 58884897 missense probably damaging 1.00
R5493:Clrn1 UTSW 3 58846416 missense probably damaging 1.00
R5916:Clrn1 UTSW 3 58846362 missense probably benign 0.13
R6393:Clrn1 UTSW 3 58846320 missense probably damaging 1.00
R6719:Clrn1 UTSW 3 58846440 missense probably damaging 0.99
R7722:Clrn1 UTSW 3 58846334 missense possibly damaging 0.52
R8824:Clrn1 UTSW 3 58884893 missense probably benign 0.12
R9342:Clrn1 UTSW 3 58884830 missense probably benign 0.01
R9681:Clrn1 UTSW 3 58884830 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCCAGCAAGTCGTATCAGGAGCC -3'
(R):5'- TCACAGCAATTTCCCAAGTGCTACC -3'

Sequencing Primer
(F):5'- AGTCGTATCAGGAGCCCATTC -3'
(R):5'- TGAGAATCAAGCTCATGACTGC -3'
Posted On 2013-08-06