Incidental Mutation 'R7939:Qdpr'
ID648929
Institutional Source Beutler Lab
Gene Symbol Qdpr
Ensembl Gene ENSMUSG00000015806
Gene Namequinoid dihydropteridine reductase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R7939 (G1)
Quality Score180.009
Status Not validated
Chromosome5
Chromosomal Location45434021-45450236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45450065 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 13 (Y13C)
Ref Sequence ENSEMBL: ENSMUSP00000015950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015950] [ENSMUST00000053250] [ENSMUST00000117425] [ENSMUST00000118097] [ENSMUST00000120867] [ENSMUST00000127562] [ENSMUST00000154962] [ENSMUST00000197946] [ENSMUST00000198258]
Predicted Effect probably damaging
Transcript: ENSMUST00000015950
AA Change: Y13C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015950
Gene: ENSMUSG00000015806
AA Change: Y13C

DomainStartEndE-ValueType
Pfam:adh_short 8 195 5.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053250
SMART Domains Protein: ENSMUSP00000058204
Gene: ENSMUSG00000049530

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 102 124 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
low complexity region 176 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117425
SMART Domains Protein: ENSMUSP00000112469
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118097
SMART Domains Protein: ENSMUSP00000113958
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120867
SMART Domains Protein: ENSMUSP00000113203
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127562
AA Change: Y13C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115453
Gene: ENSMUSG00000015806
AA Change: Y13C

DomainStartEndE-ValueType
PDB:1DIR|D 1 137 7e-67 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000154962
AA Change: Y13C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122081
Gene: ENSMUSG00000015806
AA Change: Y13C

DomainStartEndE-ValueType
PDB:1DIR|D 1 159 7e-72 PDB
SCOP:d1hdr__ 6 159 6e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197946
AA Change: Y13C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143584
Gene: ENSMUSG00000015806
AA Change: Y13C

DomainStartEndE-ValueType
PDB:1DIR|D 1 213 1e-125 PDB
SCOP:d1hdr__ 6 162 2e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198258
SMART Domains Protein: ENSMUSP00000143741
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 139 8e-86 PDB
SCOP:d1hdr__ 14 139 6e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme dihydropteridine reductase, which catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin. This enzyme is an essential component of the pterin-dependent aromatic amino acid hydroxylating systems. Mutations in this gene resulting in QDPR deficiency include aberrant splicing, amino acid substitutions, insertions, or premature terminations. Dihydropteridine reductase deficiency presents as atypical phenylketonuria due to insufficient production of biopterin, a cofactor for phenylalanine hydroxylase. [provided by RefSeq, Jul 2008]
PHENOTYPE: A portion of mice homozygous for a knock-out allele display abnormal rib-sternum attachment, a split xiphoid process, and lumbar vertebral transformation. Another knock-out allele exhibits abnormal folate and biopterin metabolism and oxidative stress in the liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 86,548,804 I415T probably damaging Het
Ackr3 A G 1: 90,214,565 S249G probably benign Het
Adgre1 G T 17: 57,449,938 A732S probably damaging Het
Ahnak T A 19: 9,014,084 L4244* probably null Het
Aldh3a2 C A 11: 61,224,598 C511F probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ankrd11 A T 8: 122,891,073 H2013Q probably damaging Het
Atp5g3 A G 2: 73,909,862 probably null Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Chtf18 A T 17: 25,722,137 I629N probably damaging Het
Clstn3 T C 6: 124,462,199 Y33C probably damaging Het
Cmc2 T C 8: 116,889,774 R71G unknown Het
Cts7 A T 13: 61,356,550 N66K probably damaging Het
Cysltr2 C T 14: 73,029,959 V104I possibly damaging Het
Dnm3 C T 1: 162,295,596 V460I possibly damaging Het
Ecel1 C T 1: 87,149,534 V651I probably benign Het
Ext2 G A 2: 93,730,256 R522C probably damaging Het
Fam129a T G 1: 151,706,024 L457R probably damaging Het
Farp2 T C 1: 93,560,261 L70P probably damaging Het
Fnip1 T C 11: 54,502,267 Y510H probably damaging Het
Gm15446 T C 5: 109,942,494 V204A probably benign Het
Gm29394 T C 15: 58,048,650 K53E unknown Het
Gm39115 T C 7: 142,136,031 T2A unknown Het
Helz2 A G 2: 181,237,750 W692R probably damaging Het
Htra2 A T 6: 83,051,564 Y428N probably damaging Het
Khdrbs2 T A 1: 32,172,975 S20T probably benign Het
Kifap3 C A 1: 163,815,858 Y217* probably null Het
Mast2 A T 4: 116,430,471 S136T probably benign Het
Mesp1 C T 7: 79,792,986 W181* probably null Het
Mtch1 A C 17: 29,340,832 S158A probably damaging Het
Mtmr10 C A 7: 64,314,151 S211R probably benign Het
Mtmr9 C A 14: 63,534,524 Q204H probably damaging Het
Myo5a A G 9: 75,189,900 N43D Het
Myom3 G T 4: 135,807,278 probably null Het
Neb T C 2: 52,186,061 D5903G probably damaging Het
Noxred1 A G 12: 87,221,331 V342A probably benign Het
Nsd2 T A 5: 33,855,589 S421R probably benign Het
Olfr476 T A 7: 107,967,779 C127* probably null Het
Olfr518 T C 7: 108,881,274 I111V probably benign Het
Oxa1l T C 14: 54,367,419 C270R probably benign Het
Pcdha3 T A 18: 36,947,880 N558K probably damaging Het
Pcdha7 T C 18: 36,976,010 V696A possibly damaging Het
Pigl T C 11: 62,458,680 L74P probably damaging Het
Plch2 G T 4: 155,002,778 R339S possibly damaging Het
Prdm11 G T 2: 93,012,729 D128E probably damaging Het
Ptdss1 A G 13: 66,995,347 T415A probably benign Het
Ptprj A T 2: 90,464,665 W400R probably damaging Het
Retsat G A 6: 72,604,936 M355I probably benign Het
Slc24a1 T G 9: 64,928,366 E826D probably benign Het
Taok3 T C 5: 117,193,837 F40L probably benign Het
Tecta T C 9: 42,388,223 T190A probably damaging Het
Tmem220 C A 11: 67,030,024 T85K probably damaging Het
Traip T C 9: 107,955,878 F38L probably benign Het
Tspan1 A T 4: 116,167,012 I18N probably damaging Het
Ttc24 A T 3: 88,074,638 D40E possibly damaging Het
Ttn A T 2: 76,712,393 Y33416* probably null Het
Ttn A T 2: 76,745,761 D24929E probably damaging Het
Vmn2r16 T A 5: 109,339,839 S193T possibly damaging Het
Vmn2r83 T A 10: 79,478,817 W300R probably damaging Het
Vps13a C T 19: 16,740,791 V522M possibly damaging Het
Wdr17 C A 8: 54,687,642 R232L probably damaging Het
Wdr78 G A 4: 103,096,601 Q134* probably null Het
Wtap A T 17: 12,981,796 Y33* probably null Het
Zc3h10 A T 10: 128,544,507 V327E probably damaging Het
Zfp658 T C 7: 43,574,877 S859P possibly damaging Het
Zfp874b A T 13: 67,474,503 C225* probably null Het
Zfp980 A T 4: 145,702,012 H437L probably damaging Het
Other mutations in Qdpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Qdpr APN 5 45434676 missense possibly damaging 0.93
R0907:Qdpr UTSW 5 45439386 missense probably benign 0.16
R1387:Qdpr UTSW 5 45450138 start gained probably benign
R1964:Qdpr UTSW 5 45439318 missense possibly damaging 0.58
R2431:Qdpr UTSW 5 45444730 missense probably damaging 1.00
R4586:Qdpr UTSW 5 45439327 missense possibly damaging 0.60
R5678:Qdpr UTSW 5 45447637 missense possibly damaging 0.65
R5754:Qdpr UTSW 5 45439385 missense probably damaging 0.98
R7392:Qdpr UTSW 5 45439376 missense probably benign 0.37
R8482:Qdpr UTSW 5 45439346 missense probably benign 0.05
X0022:Qdpr UTSW 5 45439355 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCTAGCACTTAAACGGCG -3'
(R):5'- CTATTGGTCGAAGCAGGAGG -3'

Sequencing Primer
(F):5'- TCACTAGGCTAGTAACTTAGGGC -3'
(R):5'- GTGGCTCCGCAATGTCTC -3'
Posted On2020-09-15