Incidental Mutation 'R7939:Clstn3'
ID648935
Institutional Source Beutler Lab
Gene Symbol Clstn3
Ensembl Gene ENSMUSG00000008153
Gene Namecalsyntenin 3
Synonymsalcadein-beta, Cst-3, CSTN3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7939 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location124430759-124464794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124462199 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 33 (Y33C)
Ref Sequence ENSEMBL: ENSMUSP00000008297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008297] [ENSMUST00000112523] [ENSMUST00000150774]
Predicted Effect probably damaging
Transcript: ENSMUST00000008297
AA Change: Y33C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000008297
Gene: ENSMUSG00000008153
AA Change: Y33C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CA 50 143 2.72e-12 SMART
CA 166 244 4.04e-2 SMART
SCOP:d1a8d_1 333 549 7e-23 SMART
transmembrane domain 846 868 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112523
SMART Domains Protein: ENSMUSP00000108142
Gene: ENSMUSG00000008153

DomainStartEndE-ValueType
CA 13 106 2.72e-12 SMART
CA 129 207 4.04e-2 SMART
Pfam:Laminin_G_3 304 505 4.1e-8 PFAM
transmembrane domain 809 831 N/A INTRINSIC
low complexity region 891 908 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150774
SMART Domains Protein: ENSMUSP00000145422
Gene: ENSMUSG00000008153

DomainStartEndE-ValueType
Blast:CA 13 64 4e-31 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reductions in excitatory and inhibitory synapse density and deficits in synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 86,548,804 I415T probably damaging Het
Ackr3 A G 1: 90,214,565 S249G probably benign Het
Adgre1 G T 17: 57,449,938 A732S probably damaging Het
Ahnak T A 19: 9,014,084 L4244* probably null Het
Aldh3a2 C A 11: 61,224,598 C511F probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ankrd11 A T 8: 122,891,073 H2013Q probably damaging Het
Atp5g3 A G 2: 73,909,862 probably null Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Chtf18 A T 17: 25,722,137 I629N probably damaging Het
Cmc2 T C 8: 116,889,774 R71G unknown Het
Cts7 A T 13: 61,356,550 N66K probably damaging Het
Cysltr2 C T 14: 73,029,959 V104I possibly damaging Het
Dnm3 C T 1: 162,295,596 V460I possibly damaging Het
Ecel1 C T 1: 87,149,534 V651I probably benign Het
Ext2 G A 2: 93,730,256 R522C probably damaging Het
Fam129a T G 1: 151,706,024 L457R probably damaging Het
Farp2 T C 1: 93,560,261 L70P probably damaging Het
Fnip1 T C 11: 54,502,267 Y510H probably damaging Het
Gm15446 T C 5: 109,942,494 V204A probably benign Het
Gm29394 T C 15: 58,048,650 K53E unknown Het
Gm39115 T C 7: 142,136,031 T2A unknown Het
Helz2 A G 2: 181,237,750 W692R probably damaging Het
Htra2 A T 6: 83,051,564 Y428N probably damaging Het
Khdrbs2 T A 1: 32,172,975 S20T probably benign Het
Kifap3 C A 1: 163,815,858 Y217* probably null Het
Mast2 A T 4: 116,430,471 S136T probably benign Het
Mesp1 C T 7: 79,792,986 W181* probably null Het
Mtch1 A C 17: 29,340,832 S158A probably damaging Het
Mtmr10 C A 7: 64,314,151 S211R probably benign Het
Mtmr9 C A 14: 63,534,524 Q204H probably damaging Het
Myo5a A G 9: 75,189,900 N43D Het
Myom3 G T 4: 135,807,278 probably null Het
Neb T C 2: 52,186,061 D5903G probably damaging Het
Noxred1 A G 12: 87,221,331 V342A probably benign Het
Nsd2 T A 5: 33,855,589 S421R probably benign Het
Olfr476 T A 7: 107,967,779 C127* probably null Het
Olfr518 T C 7: 108,881,274 I111V probably benign Het
Oxa1l T C 14: 54,367,419 C270R probably benign Het
Pcdha3 T A 18: 36,947,880 N558K probably damaging Het
Pcdha7 T C 18: 36,976,010 V696A possibly damaging Het
Pigl T C 11: 62,458,680 L74P probably damaging Het
Plch2 G T 4: 155,002,778 R339S possibly damaging Het
Prdm11 G T 2: 93,012,729 D128E probably damaging Het
Ptdss1 A G 13: 66,995,347 T415A probably benign Het
Ptprj A T 2: 90,464,665 W400R probably damaging Het
Qdpr T C 5: 45,450,065 Y13C probably damaging Het
Retsat G A 6: 72,604,936 M355I probably benign Het
Slc24a1 T G 9: 64,928,366 E826D probably benign Het
Taok3 T C 5: 117,193,837 F40L probably benign Het
Tecta T C 9: 42,388,223 T190A probably damaging Het
Tmem220 C A 11: 67,030,024 T85K probably damaging Het
Traip T C 9: 107,955,878 F38L probably benign Het
Tspan1 A T 4: 116,167,012 I18N probably damaging Het
Ttc24 A T 3: 88,074,638 D40E possibly damaging Het
Ttn A T 2: 76,712,393 Y33416* probably null Het
Ttn A T 2: 76,745,761 D24929E probably damaging Het
Vmn2r16 T A 5: 109,339,839 S193T possibly damaging Het
Vmn2r83 T A 10: 79,478,817 W300R probably damaging Het
Vps13a C T 19: 16,740,791 V522M possibly damaging Het
Wdr17 C A 8: 54,687,642 R232L probably damaging Het
Wdr78 G A 4: 103,096,601 Q134* probably null Het
Wtap A T 17: 12,981,796 Y33* probably null Het
Zc3h10 A T 10: 128,544,507 V327E probably damaging Het
Zfp658 T C 7: 43,574,877 S859P possibly damaging Het
Zfp874b A T 13: 67,474,503 C225* probably null Het
Zfp980 A T 4: 145,702,012 H437L probably damaging Het
Other mutations in Clstn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Clstn3 APN 6 124462139 missense probably damaging 1.00
IGL01415:Clstn3 APN 6 124438822 nonsense probably null
IGL01521:Clstn3 APN 6 124458031 nonsense probably null
IGL01537:Clstn3 APN 6 124431600 missense possibly damaging 0.91
IGL01729:Clstn3 APN 6 124449794 missense probably benign 0.06
IGL01879:Clstn3 APN 6 124438810 missense probably damaging 1.00
IGL01998:Clstn3 APN 6 124458663 missense probably damaging 1.00
IGL03130:Clstn3 APN 6 124459263 missense probably damaging 0.98
IGL03405:Clstn3 APN 6 124438368 missense possibly damaging 0.95
PIT4403001:Clstn3 UTSW 6 124458023 missense probably damaging 1.00
R0049:Clstn3 UTSW 6 124459853 missense possibly damaging 0.87
R0049:Clstn3 UTSW 6 124459853 missense possibly damaging 0.87
R0208:Clstn3 UTSW 6 124432169 splice site probably benign
R0276:Clstn3 UTSW 6 124431740 splice site probably benign
R0440:Clstn3 UTSW 6 124451413 missense probably damaging 1.00
R0612:Clstn3 UTSW 6 124449500 missense probably damaging 0.98
R1200:Clstn3 UTSW 6 124459170 missense probably damaging 1.00
R1224:Clstn3 UTSW 6 124457919 missense probably benign
R1378:Clstn3 UTSW 6 124438419 missense probably damaging 1.00
R1491:Clstn3 UTSW 6 124437490 missense possibly damaging 0.51
R1495:Clstn3 UTSW 6 124449917 missense probably benign 0.00
R1511:Clstn3 UTSW 6 124462169 missense probably damaging 1.00
R1655:Clstn3 UTSW 6 124437427 missense probably damaging 1.00
R1731:Clstn3 UTSW 6 124431632 missense probably benign 0.04
R1734:Clstn3 UTSW 6 124436814 splice site probably benign
R1751:Clstn3 UTSW 6 124431999 missense probably damaging 1.00
R1954:Clstn3 UTSW 6 124459298 missense possibly damaging 0.94
R2133:Clstn3 UTSW 6 124449503 missense probably benign
R2192:Clstn3 UTSW 6 124459207 missense probably damaging 1.00
R2314:Clstn3 UTSW 6 124450717 missense probably benign 0.39
R2874:Clstn3 UTSW 6 124438335 missense probably damaging 1.00
R3500:Clstn3 UTSW 6 124431711 missense probably benign 0.01
R3761:Clstn3 UTSW 6 124457876 missense possibly damaging 0.54
R3878:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R3927:Clstn3 UTSW 6 124451368 missense probably damaging 1.00
R3934:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R3935:Clstn3 UTSW 6 124457942 missense probably damaging 0.97
R4063:Clstn3 UTSW 6 124449833 missense possibly damaging 0.51
R4402:Clstn3 UTSW 6 124456980 missense probably damaging 0.96
R4534:Clstn3 UTSW 6 124459220 missense probably damaging 1.00
R4785:Clstn3 UTSW 6 124437372 splice site probably null
R4834:Clstn3 UTSW 6 124431953 splice site probably null
R5921:Clstn3 UTSW 6 124431580 utr 3 prime probably benign
R5932:Clstn3 UTSW 6 124438332 missense probably benign 0.01
R6025:Clstn3 UTSW 6 124431664 missense possibly damaging 0.73
R6101:Clstn3 UTSW 6 124461670 missense probably damaging 1.00
R6360:Clstn3 UTSW 6 124438429 missense possibly damaging 0.88
R6578:Clstn3 UTSW 6 124450704 critical splice donor site probably null
R6813:Clstn3 UTSW 6 124436935 missense probably benign 0.00
R7380:Clstn3 UTSW 6 124456989 missense probably benign 0.01
R7419:Clstn3 UTSW 6 124458129 missense probably benign 0.05
R7625:Clstn3 UTSW 6 124437418 nonsense probably null
R7780:Clstn3 UTSW 6 124462202 missense probably damaging 0.98
R7936:Clstn3 UTSW 6 124432013 missense possibly damaging 0.73
R8047:Clstn3 UTSW 6 124432013 missense possibly damaging 0.73
R8079:Clstn3 UTSW 6 124459804 missense probably damaging 1.00
R8085:Clstn3 UTSW 6 124458724 missense probably benign 0.23
R8299:Clstn3 UTSW 6 124437373 critical splice donor site probably null
R8406:Clstn3 UTSW 6 124462177 missense probably damaging 1.00
RF014:Clstn3 UTSW 6 124459266 nonsense probably null
X0066:Clstn3 UTSW 6 124449811 missense probably benign 0.13
Z1176:Clstn3 UTSW 6 124459200 missense probably damaging 1.00
Z1177:Clstn3 UTSW 6 124449781 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACCTTAGGTTCTTCAGCGC -3'
(R):5'- TACGAGAGTTGCTGGTTCCTTC -3'

Sequencing Primer
(F):5'- CTGATGCTTTCCCTGGGCTTG -3'
(R):5'- AGAGTTGCTGGTTCCTTCTGTAGC -3'
Posted On2020-09-15