Incidental Mutation 'R0015:Espn'
ID64894
Institutional Source Beutler Lab
Gene Symbol Espn
Ensembl Gene ENSMUSG00000028943
Gene Nameespin
Synonyms
MMRRC Submission 038310-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R0015 (G1)
Quality Score145
Status Validated
Chromosome4
Chromosomal Location152120331-152152371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152139152 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 188 (T188A)
Ref Sequence ENSEMBL: ENSMUSP00000101284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030785] [ENSMUST00000070018] [ENSMUST00000080042] [ENSMUST00000084114] [ENSMUST00000103196] [ENSMUST00000105654] [ENSMUST00000105655] [ENSMUST00000105656] [ENSMUST00000105657] [ENSMUST00000105658] [ENSMUST00000105659] [ENSMUST00000135185] [ENSMUST00000207676]
Predicted Effect probably benign
Transcript: ENSMUST00000030785
AA Change: T188A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030785
Gene: ENSMUSG00000028943
AA Change: T188A

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 428 465 N/A INTRINSIC
low complexity region 605 629 N/A INTRINSIC
WH2 669 686 4.82e-3 SMART
low complexity region 714 728 N/A INTRINSIC
low complexity region 740 748 N/A INTRINSIC
coiled coil region 772 848 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070018
SMART Domains Protein: ENSMUSP00000065545
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
WH2 322 339 4.82e-3 SMART
low complexity region 367 381 N/A INTRINSIC
low complexity region 393 401 N/A INTRINSIC
SCOP:d1eq1a_ 432 499 4e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080042
SMART Domains Protein: ENSMUSP00000078951
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 186 210 N/A INTRINSIC
WH2 250 267 4.82e-3 SMART
low complexity region 295 309 N/A INTRINSIC
low complexity region 321 329 N/A INTRINSIC
SCOP:d1eq1a_ 360 427 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084114
SMART Domains Protein: ENSMUSP00000081131
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 267 291 N/A INTRINSIC
WH2 331 348 4.82e-3 SMART
low complexity region 376 390 N/A INTRINSIC
low complexity region 402 410 N/A INTRINSIC
SCOP:d1eq1a_ 441 508 6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103196
SMART Domains Protein: ENSMUSP00000099485
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 183 207 N/A INTRINSIC
low complexity region 220 229 N/A INTRINSIC
WH2 238 255 4.82e-3 SMART
low complexity region 283 297 N/A INTRINSIC
low complexity region 309 317 N/A INTRINSIC
SCOP:d1eq1a_ 348 415 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105654
SMART Domains Protein: ENSMUSP00000101279
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 264 288 N/A INTRINSIC
low complexity region 301 310 N/A INTRINSIC
WH2 319 336 4.82e-3 SMART
low complexity region 364 378 N/A INTRINSIC
low complexity region 390 398 N/A INTRINSIC
SCOP:d1eq1a_ 429 496 6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105655
SMART Domains Protein: ENSMUSP00000101280
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 183 207 N/A INTRINSIC
WH2 247 264 4.82e-3 SMART
low complexity region 292 306 N/A INTRINSIC
low complexity region 318 326 N/A INTRINSIC
SCOP:d1eq1a_ 357 424 3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105656
SMART Domains Protein: ENSMUSP00000101281
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 98 135 N/A INTRINSIC
low complexity region 264 288 N/A INTRINSIC
WH2 328 345 4.82e-3 SMART
low complexity region 373 387 N/A INTRINSIC
low complexity region 399 407 N/A INTRINSIC
SCOP:d1eq1a_ 438 505 8e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105657
SMART Domains Protein: ENSMUSP00000101282
Gene: ENSMUSG00000028943

DomainStartEndE-ValueType
low complexity region 50 68 N/A INTRINSIC
low complexity region 101 138 N/A INTRINSIC
low complexity region 186 210 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
WH2 241 258 4.82e-3 SMART
low complexity region 286 300 N/A INTRINSIC
low complexity region 312 320 N/A INTRINSIC
SCOP:d1eq1a_ 351 418 2e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105658
AA Change: T188A

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101283
Gene: ENSMUSG00000028943
AA Change: T188A

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 425 462 N/A INTRINSIC
low complexity region 591 615 N/A INTRINSIC
low complexity region 628 637 N/A INTRINSIC
WH2 646 663 4.82e-3 SMART
low complexity region 691 705 N/A INTRINSIC
low complexity region 717 725 N/A INTRINSIC
coiled coil region 749 825 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105659
AA Change: T188A

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101284
Gene: ENSMUSG00000028943
AA Change: T188A

DomainStartEndE-ValueType
ANK 35 64 3.26e0 SMART
ANK 69 99 1.15e0 SMART
ANK 103 133 2.58e-3 SMART
ANK 137 167 1.63e0 SMART
ANK 171 201 4.97e-5 SMART
ANK 205 235 3.08e-1 SMART
ANK 239 268 9.13e-4 SMART
ANK 271 300 2.15e0 SMART
ANK 304 334 2.08e3 SMART
low complexity region 377 395 N/A INTRINSIC
low complexity region 428 465 N/A INTRINSIC
low complexity region 624 648 N/A INTRINSIC
low complexity region 661 670 N/A INTRINSIC
WH2 679 696 4.82e-3 SMART
low complexity region 724 738 N/A INTRINSIC
low complexity region 750 758 N/A INTRINSIC
coiled coil region 782 858 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135185
AA Change: T90A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000122464
Gene: ENSMUSG00000028943
AA Change: T90A

DomainStartEndE-ValueType
ANK 5 35 2.58e-3 SMART
ANK 39 69 1.63e0 SMART
ANK 73 103 4.97e-5 SMART
ANK 107 137 3.08e-1 SMART
ANK 141 170 9.13e-4 SMART
ANK 173 202 2.15e0 SMART
ANK 206 236 2.08e3 SMART
low complexity region 279 297 N/A INTRINSIC
low complexity region 330 367 N/A INTRINSIC
low complexity region 496 520 N/A INTRINSIC
low complexity region 533 542 N/A INTRINSIC
WH2 551 568 4.82e-3 SMART
low complexity region 596 610 N/A INTRINSIC
low complexity region 622 630 N/A INTRINSIC
coiled coil region 654 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207676
AA Change: T188A

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0711 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional actin-bundling protein. It plays a major role in regulating the organization, dimensions, dynamics, and signaling capacities of the actin filament-rich, microvillus-type specializations that mediate sensory transduction in various mechanosensory and chemosensory cells. Mutations in this gene are associated with autosomal recessive neurosensory deafness, and autosomal dominant sensorineural deafness without vestibular involvement. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit progressive degeneration of both inner and outer hair cells, severe deafness, vestibular dysfunction, and poor mothering ability. Heterozygotes show a progressive, age-related hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,186,184 R408H probably damaging Het
A130050O07Rik A G 1: 137,928,656 Y23C unknown Het
Adcy3 G A 12: 4,195,260 probably null Het
Aldh6a1 G A 12: 84,441,780 L86F probably damaging Het
Arl10 G T 13: 54,575,957 probably benign Het
Armc3 A G 2: 19,296,321 probably null Het
Astn2 T G 4: 66,266,382 probably null Het
Cacna1d G A 14: 30,114,971 T804I probably benign Het
Ccny A C 18: 9,316,682 probably benign Het
Cdh5 C T 8: 104,140,927 T612I probably benign Het
Cfap58 A G 19: 48,029,100 M800V probably benign Het
Clrn1 A T 3: 58,846,427 I171K probably damaging Het
Cnp T A 11: 100,578,908 probably null Het
Col12a1 T C 9: 79,651,385 T1933A probably damaging Het
Cwf19l2 A G 9: 3,454,666 S660G probably benign Het
Dync1i2 C A 2: 71,214,484 R13S probably damaging Het
Eps8l1 A T 7: 4,477,557 probably benign Het
F2 T C 2: 91,630,607 E260G probably benign Het
Fat4 T A 3: 38,982,503 S3435T probably damaging Het
Fchsd1 A G 18: 37,962,959 C533R probably benign Het
Fstl5 G A 3: 76,322,191 V100M probably damaging Het
Gls2 T G 10: 128,209,350 L572R probably damaging Het
Gm20939 A T 17: 94,876,768 E281D probably benign Het
Gpr35 T G 1: 92,983,232 L222W probably damaging Het
Hsf5 C A 11: 87,657,335 H615N probably benign Het
Id2 C T 12: 25,095,803 D70N probably damaging Het
Ints2 T C 11: 86,249,287 T240A probably damaging Het
Kcnn3 A C 3: 89,662,773 D631A probably damaging Het
Klhdc8a A G 1: 132,303,005 T203A probably damaging Het
Lama4 C T 10: 39,075,436 T1059M possibly damaging Het
Lgals8 A G 13: 12,447,298 L226P probably damaging Het
Lifr T A 15: 7,188,186 probably null Het
Lonp1 T A 17: 56,618,406 Q462L probably benign Het
Lypd1 A G 1: 125,910,438 V48A possibly damaging Het
Mapkapk2 A G 1: 131,097,326 I67T possibly damaging Het
Mbd3l1 A T 9: 18,484,858 D93V probably benign Het
Mdh1b T C 1: 63,721,800 probably benign Het
Myh7b C T 2: 155,622,286 P569L probably damaging Het
Ncapd3 C A 9: 27,051,809 A470E probably damaging Het
Ndrg2 A G 14: 51,910,445 probably benign Het
Nprl2 A T 9: 107,544,419 I209F probably damaging Het
Ntrk1 A G 3: 87,791,750 probably benign Het
Olfm2 T C 9: 20,668,741 E268G probably damaging Het
Olfr884 T A 9: 38,047,667 Y148* probably null Het
Pcf11 T A 7: 92,658,317 H881L probably benign Het
Pde10a A G 17: 8,977,197 D640G probably damaging Het
Pde9a G A 17: 31,386,356 probably null Het
Pianp G T 6: 125,001,540 G236V probably damaging Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Ppp1r3a A G 6: 14,717,661 S1085P possibly damaging Het
Pter G A 2: 13,001,000 G328D probably damaging Het
Rad51 T A 2: 119,116,327 M5K probably benign Het
Rbm43 T A 2: 51,925,667 I181F probably benign Het
Rgs12 T C 5: 35,022,776 probably benign Het
Rnf213 A C 11: 119,441,606 D2547A possibly damaging Het
Slc20a2 C A 8: 22,535,345 A21E probably damaging Het
Stab2 A G 10: 86,843,617 S2503P probably benign Het
Sv2b A T 7: 75,125,641 F479L probably damaging Het
Sybu T C 15: 44,673,500 R349G probably damaging Het
Tead3 T C 17: 28,341,351 Y2C probably damaging Het
Tnrc6c T A 11: 117,721,458 N307K probably damaging Het
Ubxn11 C G 4: 134,116,025 probably null Het
Ust T C 10: 8,330,065 probably benign Het
Vmn2r116 T A 17: 23,401,849 N852K probably benign Het
Zgrf1 T C 3: 127,555,397 probably benign Het
Other mutations in Espn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Espn APN 4 152135602 missense probably damaging 1.00
IGL01404:Espn APN 4 152138444 missense probably benign 0.03
IGL01576:Espn APN 4 152123717 missense probably damaging 1.00
R1475:Espn UTSW 4 152134271 missense probably damaging 1.00
R1773:Espn UTSW 4 152128229 missense probably damaging 1.00
R1992:Espn UTSW 4 152128555 critical splice acceptor site probably null
R2014:Espn UTSW 4 152132959 splice site probably null
R2049:Espn UTSW 4 152121257 missense probably damaging 0.99
R2281:Espn UTSW 4 152135545 missense possibly damaging 0.94
R4278:Espn UTSW 4 152134417 missense probably damaging 1.00
R4527:Espn UTSW 4 152135649 missense probably damaging 0.99
R4539:Espn UTSW 4 152134208 nonsense probably null
R4621:Espn UTSW 4 152131252 missense probably damaging 1.00
R4839:Espn UTSW 4 152138504 missense probably damaging 0.99
R4860:Espn UTSW 4 152138846 missense probably damaging 0.99
R4860:Espn UTSW 4 152138846 missense probably damaging 0.99
R4998:Espn UTSW 4 152135583 missense possibly damaging 0.94
R5412:Espn UTSW 4 152128125 missense probably damaging 1.00
R5570:Espn UTSW 4 152123780 missense probably damaging 1.00
R6549:Espn UTSW 4 152131068 start codon destroyed probably null 0.99
R6551:Espn UTSW 4 152128766
R7124:Espn UTSW 4 152131264 missense probably benign 0.00
R7838:Espn UTSW 4 152131281 missense possibly damaging 0.95
R7863:Espn UTSW 4 152152159 missense probably damaging 0.99
R8236:Espn UTSW 4 152149030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAACGTCTGCAAAGCTCACCTG -3'
(R):5'- TTTCAGCACTCCAGAGAGCCAAGC -3'

Sequencing Primer
(F):5'- CCACACCAAGACTGGGTTG -3'
(R):5'- CTCCAGAGAGCCAAGCTAAAGG -3'
Posted On2013-08-06