Incidental Mutation 'R7939:Chtf18'
ID648966
Institutional Source Beutler Lab
Gene Symbol Chtf18
Ensembl Gene ENSMUSG00000019214
Gene NameCTF18, chromosome transmission fidelity factor 18
Synonyms6030457M03Rik, CTF18
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R7939 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25718926-25727419 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25722137 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 629 (I629N)
Ref Sequence ENSEMBL: ENSMUSP00000043896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048054] [ENSMUST00000115108] [ENSMUST00000167940] [ENSMUST00000170070] [ENSMUST00000170575] [ENSMUST00000172002]
Predicted Effect probably damaging
Transcript: ENSMUST00000048054
AA Change: I629N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043896
Gene: ENSMUSG00000019214
AA Change: I629N

DomainStartEndE-ValueType
low complexity region 20 30 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
low complexity region 117 130 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 228 255 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
AAA 361 518 1.99e-11 SMART
low complexity region 646 661 N/A INTRINSIC
Blast:AAA 728 850 7e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000115108
SMART Domains Protein: ENSMUSP00000110760
Gene: ENSMUSG00000025739

DomainStartEndE-ValueType
G_gamma 3 67 1.32e-16 SMART
GGL 6 67 2.09e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167940
SMART Domains Protein: ENSMUSP00000131349
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Blast:AAA 21 107 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169767
Predicted Effect probably benign
Transcript: ENSMUST00000170070
SMART Domains Protein: ENSMUSP00000131768
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 155 169 N/A INTRINSIC
coiled coil region 229 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170575
SMART Domains Protein: ENSMUSP00000131366
Gene: ENSMUSG00000019214

DomainStartEndE-ValueType
low complexity region 20 31 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 155 169 N/A INTRINSIC
coiled coil region 229 256 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
low complexity region 344 355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172002
SMART Domains Protein: ENSMUSP00000131648
Gene: ENSMUSG00000025739

DomainStartEndE-ValueType
G_gamma 3 67 1.32e-16 SMART
GGL 6 67 2.09e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a component of a replication factor C (RFC) complex, which loads proliferating cell nuclear antigen (PCNA) on to DNA during the S phase of cell cycle. The encoded protein may interact with other proteins, including RFC complex 3, to form a clamp loader complex that plays a role in sister chromatid cohesion during metaphase-anaphase transition. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality, reduced body and testis weight, defective male meiosis, impaired spermatogenesis, oligozoospermia, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 86,548,804 I415T probably damaging Het
Ackr3 A G 1: 90,214,565 S249G probably benign Het
Adgre1 G T 17: 57,449,938 A732S probably damaging Het
Ahnak T A 19: 9,014,084 L4244* probably null Het
Aldh3a2 C A 11: 61,224,598 C511F probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ankrd11 A T 8: 122,891,073 H2013Q probably damaging Het
Atp5g3 A G 2: 73,909,862 probably null Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Clstn3 T C 6: 124,462,199 Y33C probably damaging Het
Cmc2 T C 8: 116,889,774 R71G unknown Het
Cts7 A T 13: 61,356,550 N66K probably damaging Het
Cysltr2 C T 14: 73,029,959 V104I possibly damaging Het
Dnm3 C T 1: 162,295,596 V460I possibly damaging Het
Ecel1 C T 1: 87,149,534 V651I probably benign Het
Ext2 G A 2: 93,730,256 R522C probably damaging Het
Fam129a T G 1: 151,706,024 L457R probably damaging Het
Farp2 T C 1: 93,560,261 L70P probably damaging Het
Fnip1 T C 11: 54,502,267 Y510H probably damaging Het
Gm15446 T C 5: 109,942,494 V204A probably benign Het
Gm29394 T C 15: 58,048,650 K53E unknown Het
Gm39115 T C 7: 142,136,031 T2A unknown Het
Helz2 A G 2: 181,237,750 W692R probably damaging Het
Htra2 A T 6: 83,051,564 Y428N probably damaging Het
Khdrbs2 T A 1: 32,172,975 S20T probably benign Het
Kifap3 C A 1: 163,815,858 Y217* probably null Het
Mast2 A T 4: 116,430,471 S136T probably benign Het
Mesp1 C T 7: 79,792,986 W181* probably null Het
Mtch1 A C 17: 29,340,832 S158A probably damaging Het
Mtmr10 C A 7: 64,314,151 S211R probably benign Het
Mtmr9 C A 14: 63,534,524 Q204H probably damaging Het
Myo5a A G 9: 75,189,900 N43D Het
Myom3 G T 4: 135,807,278 probably null Het
Neb T C 2: 52,186,061 D5903G probably damaging Het
Noxred1 A G 12: 87,221,331 V342A probably benign Het
Nsd2 T A 5: 33,855,589 S421R probably benign Het
Olfr476 T A 7: 107,967,779 C127* probably null Het
Olfr518 T C 7: 108,881,274 I111V probably benign Het
Oxa1l T C 14: 54,367,419 C270R probably benign Het
Pcdha3 T A 18: 36,947,880 N558K probably damaging Het
Pcdha7 T C 18: 36,976,010 V696A possibly damaging Het
Pigl T C 11: 62,458,680 L74P probably damaging Het
Plch2 G T 4: 155,002,778 R339S possibly damaging Het
Prdm11 G T 2: 93,012,729 D128E probably damaging Het
Ptdss1 A G 13: 66,995,347 T415A probably benign Het
Ptprj A T 2: 90,464,665 W400R probably damaging Het
Qdpr T C 5: 45,450,065 Y13C probably damaging Het
Retsat G A 6: 72,604,936 M355I probably benign Het
Slc24a1 T G 9: 64,928,366 E826D probably benign Het
Taok3 T C 5: 117,193,837 F40L probably benign Het
Tecta T C 9: 42,388,223 T190A probably damaging Het
Tmem220 C A 11: 67,030,024 T85K probably damaging Het
Traip T C 9: 107,955,878 F38L probably benign Het
Tspan1 A T 4: 116,167,012 I18N probably damaging Het
Ttc24 A T 3: 88,074,638 D40E possibly damaging Het
Ttn A T 2: 76,712,393 Y33416* probably null Het
Ttn A T 2: 76,745,761 D24929E probably damaging Het
Vmn2r16 T A 5: 109,339,839 S193T possibly damaging Het
Vmn2r83 T A 10: 79,478,817 W300R probably damaging Het
Vps13a C T 19: 16,740,791 V522M possibly damaging Het
Wdr17 C A 8: 54,687,642 R232L probably damaging Het
Wdr78 G A 4: 103,096,601 Q134* probably null Het
Wtap A T 17: 12,981,796 Y33* probably null Het
Zc3h10 A T 10: 128,544,507 V327E probably damaging Het
Zfp658 T C 7: 43,574,877 S859P possibly damaging Het
Zfp874b A T 13: 67,474,503 C225* probably null Het
Zfp980 A T 4: 145,702,012 H437L probably damaging Het
Other mutations in Chtf18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Chtf18 APN 17 25722116 missense probably benign 0.32
IGL02117:Chtf18 APN 17 25722203 missense possibly damaging 0.63
IGL03034:Chtf18 APN 17 25727346 utr 5 prime probably benign
IGL03051:Chtf18 APN 17 25720964 missense probably damaging 1.00
IGL03164:Chtf18 APN 17 25726842 missense probably benign 0.24
R0046:Chtf18 UTSW 17 25723460 missense probably benign 0.06
R0129:Chtf18 UTSW 17 25727311 nonsense probably null
R1122:Chtf18 UTSW 17 25724623 missense probably damaging 1.00
R1302:Chtf18 UTSW 17 25719158 missense probably damaging 1.00
R1487:Chtf18 UTSW 17 25720609 missense probably benign 0.00
R1614:Chtf18 UTSW 17 25727090 missense probably benign 0.00
R1820:Chtf18 UTSW 17 25725939 missense probably damaging 1.00
R4051:Chtf18 UTSW 17 25719194 missense probably damaging 0.98
R4357:Chtf18 UTSW 17 25719132 missense probably benign 0.09
R4529:Chtf18 UTSW 17 25720618 missense probably damaging 1.00
R4804:Chtf18 UTSW 17 25719257 missense probably benign
R4975:Chtf18 UTSW 17 25724566 missense possibly damaging 0.72
R5154:Chtf18 UTSW 17 25723720 missense probably damaging 1.00
R6113:Chtf18 UTSW 17 25722867 missense probably damaging 1.00
R6118:Chtf18 UTSW 17 25719159 missense probably damaging 1.00
R6446:Chtf18 UTSW 17 25721244 missense probably benign 0.01
R7057:Chtf18 UTSW 17 25721126 missense possibly damaging 0.49
R7095:Chtf18 UTSW 17 25722678 missense probably damaging 1.00
R7482:Chtf18 UTSW 17 25719989 missense possibly damaging 0.48
R7641:Chtf18 UTSW 17 25722275 splice site probably null
R7729:Chtf18 UTSW 17 25723517 missense probably damaging 1.00
R8007:Chtf18 UTSW 17 25725534 missense probably damaging 0.96
R8051:Chtf18 UTSW 17 25723479 missense probably benign 0.05
R8296:Chtf18 UTSW 17 25722191 missense probably benign 0.00
R8321:Chtf18 UTSW 17 25720891 missense probably benign 0.32
R8433:Chtf18 UTSW 17 25726944 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGATGGTTCCCAGTTACC -3'
(R):5'- AATGTGGCTAGGATGGCTGC -3'

Sequencing Primer
(F):5'- AGATGGTTCCCAGTTACCAGCTC -3'
(R):5'- GGCTGCCGGCACCTTTG -3'
Posted On2020-09-15