Incidental Mutation 'R7940:Mrps9'
ID 648974
Institutional Source Beutler Lab
Gene Symbol Mrps9
Ensembl Gene ENSMUSG00000060679
Gene Name mitochondrial ribosomal protein S9
Synonyms 2310002A08Rik
MMRRC Submission 045986-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.895) question?
Stock # R7940 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 42890393-42944843 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 42901808 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 105 (D105E)
Ref Sequence ENSEMBL: ENSMUSP00000056855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057208]
AlphaFold Q9D7N3
Predicted Effect probably damaging
Transcript: ENSMUST00000057208
AA Change: D105E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056855
Gene: ENSMUSG00000060679
AA Change: D105E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
Pfam:Ribosomal_S9 268 390 7.3e-39 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 130,952,767 (GRCm39) M238T probably benign Het
Acacb C T 5: 114,304,108 (GRCm39) S177F possibly damaging Het
Afap1l2 A G 19: 56,902,597 (GRCm39) V822A probably damaging Het
Alpk3 C T 7: 80,743,693 (GRCm39) P1170L probably damaging Het
Aox3 A G 1: 58,227,596 (GRCm39) I1234V probably damaging Het
Ascc1 G A 10: 59,848,381 (GRCm39) V103M probably null Het
Brca2 C G 5: 150,462,198 (GRCm39) T654S probably benign Het
Cblb T C 16: 51,972,899 (GRCm39) F410S probably damaging Het
Cep95 T A 11: 106,686,974 (GRCm39) N94K probably benign Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cpe T A 8: 65,047,945 (GRCm39) S440C probably damaging Het
Cspg4 C T 9: 56,795,381 (GRCm39) Q1039* probably null Het
Cul5 A T 9: 53,535,069 (GRCm39) S612T probably benign Het
Dapl1 T C 2: 59,315,112 (GRCm39) probably null Het
Deptor C T 15: 55,072,244 (GRCm39) T241M probably benign Het
Dnaaf1 A G 8: 120,309,454 (GRCm39) T181A possibly damaging Het
Dnajc11 G T 4: 152,053,045 (GRCm39) Q156H probably benign Het
Dst T C 1: 34,206,757 (GRCm39) V975A possibly damaging Het
Elf3 T A 1: 135,184,866 (GRCm39) S107C probably damaging Het
Enpp2 T A 15: 54,770,324 (GRCm39) D105V probably damaging Het
Fgd6 G A 10: 93,956,344 (GRCm39) V1008I probably benign Het
Frmpd2 C T 14: 33,276,850 (GRCm39) R1157* probably null Het
Gabrg2 A C 11: 41,858,474 (GRCm39) V218G probably benign Het
Gdpgp1 C T 7: 79,888,953 (GRCm39) A328V probably damaging Het
Glis1 C G 4: 107,489,571 (GRCm39) F719L probably damaging Het
Glis1 A T 4: 107,489,572 (GRCm39) N720Y probably damaging Het
Grin2c G T 11: 115,146,107 (GRCm39) A546D probably damaging Het
Gtf3c5 G A 2: 28,458,592 (GRCm39) T433I possibly damaging Het
Jmjd6 C A 11: 116,734,055 (GRCm39) probably benign Het
Kctd14 T C 7: 97,106,891 (GRCm39) S49P probably damaging Het
Lamc2 T A 1: 153,006,521 (GRCm39) K877* probably null Het
Lgr4 T A 2: 109,836,858 (GRCm39) S397R probably damaging Het
Lrp2 A T 2: 69,262,541 (GRCm39) I4420N possibly damaging Het
Lyn A G 4: 3,783,089 (GRCm39) K441E possibly damaging Het
Minpp1 A T 19: 32,463,359 (GRCm39) S7C possibly damaging Het
Ncoa1 C A 12: 4,363,095 (GRCm39) A247S possibly damaging Het
Or52b4i G A 7: 102,191,515 (GRCm39) R124H possibly damaging Het
Or8c15 T C 9: 38,120,496 (GRCm39) V47A probably benign Het
Pabir1 G A 19: 24,454,552 (GRCm39) R57W probably benign Het
Pakap A G 4: 57,883,026 (GRCm39) K790E probably damaging Het
Pcdh15 G A 10: 74,430,022 (GRCm39) V1250I probably damaging Het
Pcdha12 A T 18: 37,153,409 (GRCm39) T43S probably damaging Het
Pkn2 G A 3: 142,516,480 (GRCm39) R549C probably benign Het
Plscr4 C T 9: 92,372,843 (GRCm39) R322* probably null Het
Polq T A 16: 36,881,004 (GRCm39) M1056K probably benign Het
Ppp1r12b A T 1: 134,803,793 (GRCm39) N455K probably benign Het
Rhbdf1 T A 11: 32,166,258 (GRCm39) M1L possibly damaging Het
Rspry1 G T 8: 95,349,635 (GRCm39) V8L probably benign Het
Slc6a20b A G 9: 123,436,666 (GRCm39) V249A probably damaging Het
Smok2b A T 17: 13,455,046 (GRCm39) H402L possibly damaging Het
Supt20 A T 3: 54,620,620 (GRCm39) N393I probably benign Het
Tcp11l1 T C 2: 104,528,993 (GRCm39) K102E probably damaging Het
Tpbgl T C 7: 99,274,798 (GRCm39) Y353C probably damaging Het
Usp24 A T 4: 106,287,741 (GRCm39) Q2465L probably damaging Het
Vmn2r116 T A 17: 23,605,946 (GRCm39) M286K probably damaging Het
Wnt16 C A 6: 22,291,188 (GRCm39) N205K possibly damaging Het
Xkr7 C A 2: 152,874,135 (GRCm39) F67L probably damaging Het
Zfp473 T G 7: 44,384,000 (GRCm39) E111A probably damaging Het
Zfp74 T C 7: 29,631,867 (GRCm39) K126E probably benign Het
Other mutations in Mrps9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Mrps9 APN 1 42,944,619 (GRCm39) missense probably damaging 1.00
IGL01134:Mrps9 APN 1 42,942,557 (GRCm39) missense probably damaging 0.97
IGL01557:Mrps9 APN 1 42,890,510 (GRCm39) missense probably benign
IGL02541:Mrps9 APN 1 42,901,814 (GRCm39) splice site probably null
PIT4402001:Mrps9 UTSW 1 42,935,258 (GRCm39) missense probably benign 0.10
R0598:Mrps9 UTSW 1 42,944,577 (GRCm39) missense probably damaging 1.00
R1718:Mrps9 UTSW 1 42,942,559 (GRCm39) missense probably damaging 1.00
R4195:Mrps9 UTSW 1 42,940,254 (GRCm39) intron probably benign
R4196:Mrps9 UTSW 1 42,940,254 (GRCm39) intron probably benign
R4695:Mrps9 UTSW 1 42,901,675 (GRCm39) missense possibly damaging 0.59
R4840:Mrps9 UTSW 1 42,937,575 (GRCm39) intron probably benign
R5033:Mrps9 UTSW 1 42,934,491 (GRCm39) splice site probably null
R5489:Mrps9 UTSW 1 42,937,593 (GRCm39) splice site probably benign
R5876:Mrps9 UTSW 1 42,934,538 (GRCm39) missense probably damaging 0.99
R6891:Mrps9 UTSW 1 42,944,573 (GRCm39) missense probably damaging 1.00
R7015:Mrps9 UTSW 1 42,937,706 (GRCm39) missense probably benign 0.04
R8679:Mrps9 UTSW 1 42,918,915 (GRCm39) missense probably damaging 0.99
R9117:Mrps9 UTSW 1 42,942,537 (GRCm39) missense probably benign 0.22
Z1177:Mrps9 UTSW 1 42,938,618 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACAGTGGCCTGCTAATTCACTG -3'
(R):5'- TCTCTAGCCAAGGGGAAGAAC -3'

Sequencing Primer
(F):5'- GGCCTGCTAATTCACTGTTTAATTTC -3'
(R):5'- TTACTCAAACAACGTGAAGTATCAG -3'
Posted On 2020-09-15