Incidental Mutation 'R7940:Aox3'
ID648975
Institutional Source Beutler Lab
Gene Symbol Aox3
Ensembl Gene ENSMUSG00000064294
Gene Namealdehyde oxidase 3
SynonymsAOH1, 1200011D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7940 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location58113130-58200698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58188437 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1234 (I1234V)
Ref Sequence ENSEMBL: ENSMUSP00000049391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040999]
PDB Structure
Crystal structure of the mouse liver Aldehyde Oxidase 3 (mAOX3) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000040999
AA Change: I1234V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049391
Gene: ENSMUSG00000064294
AA Change: I1234V

DomainStartEndE-ValueType
Pfam:Fer2 12 82 1.4e-9 PFAM
Pfam:Fer2_2 91 165 1e-29 PFAM
Pfam:FAD_binding_5 239 419 1e-44 PFAM
CO_deh_flav_C 426 530 9.26e-24 SMART
Ald_Xan_dh_C 594 697 2.27e-41 SMART
Pfam:Ald_Xan_dh_C2 708 1241 8.7e-183 PFAM
low complexity region 1275 1286 N/A INTRINSIC
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 131,351,038 M238T probably benign Het
Acacb C T 5: 114,166,047 S177F possibly damaging Het
Afap1l2 A G 19: 56,914,165 V822A probably damaging Het
Akap2 A G 4: 57,883,026 K790E probably damaging Het
Alpk3 C T 7: 81,093,945 P1170L probably damaging Het
Ascc1 G A 10: 60,012,559 V103M probably null Het
Brca2 C G 5: 150,538,733 T654S probably benign Het
Cblb T C 16: 52,152,536 F410S probably damaging Het
Cep95 T A 11: 106,796,148 N94K probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cpe T A 8: 64,594,911 S440C probably damaging Het
Cspg4 C T 9: 56,888,097 Q1039* probably null Het
Cul5 A T 9: 53,623,769 S612T probably benign Het
Dapl1 T C 2: 59,484,768 probably null Het
Deptor C T 15: 55,208,848 T241M probably benign Het
Dnaaf1 A G 8: 119,582,715 T181A possibly damaging Het
Dnajc11 G T 4: 151,968,588 Q156H probably benign Het
Dst T C 1: 34,167,676 V975A possibly damaging Het
Elf3 T A 1: 135,257,128 S107C probably damaging Het
Enpp2 T A 15: 54,906,928 D105V probably damaging Het
Fam122a G A 19: 24,477,188 R57W probably benign Het
Fgd6 G A 10: 94,120,482 V1008I probably benign Het
Frmpd2 C T 14: 33,554,893 R1157* probably null Het
Gabrg2 A C 11: 41,967,647 V218G probably benign Het
Gdpgp1 C T 7: 80,239,205 A328V probably damaging Het
Glis1 C G 4: 107,632,374 F719L probably damaging Het
Glis1 A T 4: 107,632,375 N720Y probably damaging Het
Grin2c G T 11: 115,255,281 A546D probably damaging Het
Gtf3c5 G A 2: 28,568,580 T433I possibly damaging Het
Jmjd6 C A 11: 116,843,229 probably benign Het
Kctd14 T C 7: 97,457,684 S49P probably damaging Het
Lamc2 T A 1: 153,130,775 K877* probably null Het
Lgr4 T A 2: 110,006,513 S397R probably damaging Het
Lrp2 A T 2: 69,432,197 I4420N possibly damaging Het
Lyn A G 4: 3,783,089 K441E possibly damaging Het
Minpp1 A T 19: 32,485,959 S7C possibly damaging Het
Mrps9 T A 1: 42,862,648 D105E probably damaging Het
Ncoa1 C A 12: 4,313,095 A247S possibly damaging Het
Olfr548-ps1 G A 7: 102,542,308 R124H possibly damaging Het
Olfr893 T C 9: 38,209,200 V47A probably benign Het
Pcdh15 G A 10: 74,594,190 V1250I probably damaging Het
Pcdha12 A T 18: 37,020,356 T43S probably damaging Het
Pkn2 G A 3: 142,810,719 R549C probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Polq T A 16: 37,060,642 M1056K probably benign Het
Ppp1r12b A T 1: 134,876,055 N455K probably benign Het
Rhbdf1 T A 11: 32,216,258 M1L possibly damaging Het
Rspry1 G T 8: 94,623,007 V8L probably benign Het
Slc6a20b A G 9: 123,607,601 V249A probably damaging Het
Smok2b A T 17: 13,236,159 H402L possibly damaging Het
Supt20 A T 3: 54,713,199 N393I probably benign Het
Tcp11l1 T C 2: 104,698,648 K102E probably damaging Het
Tpbgl T C 7: 99,625,591 Y353C probably damaging Het
Usp24 A T 4: 106,430,544 Q2465L probably damaging Het
Vmn2r116 T A 17: 23,386,972 M286K probably damaging Het
Wnt16 C A 6: 22,291,189 N205K possibly damaging Het
Xkr7 C A 2: 153,032,215 F67L probably damaging Het
Zfp473 T G 7: 44,734,576 E111A probably damaging Het
Zfp74 T C 7: 29,932,442 K126E probably benign Het
Other mutations in Aox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Aox3 APN 1 58169794 missense probably damaging 1.00
IGL01747:Aox3 APN 1 58159658 missense probably damaging 0.97
IGL01883:Aox3 APN 1 58138283 missense probably damaging 1.00
IGL01911:Aox3 APN 1 58152560 missense probably benign 0.04
IGL02017:Aox3 APN 1 58120992 missense probably damaging 1.00
IGL02120:Aox3 APN 1 58127650 missense probably benign 0.00
IGL02466:Aox3 APN 1 58158272 missense probably benign 0.28
IGL02545:Aox3 APN 1 58183486 missense probably damaging 1.00
IGL02572:Aox3 APN 1 58158367 missense probably damaging 1.00
IGL02746:Aox3 APN 1 58183542 missense possibly damaging 0.83
IGL02808:Aox3 APN 1 58142700 missense probably damaging 0.99
IGL02812:Aox3 APN 1 58165896 missense probably benign 0.00
IGL02982:Aox3 APN 1 58127687 missense probably benign 0.00
IGL03056:Aox3 APN 1 58159021 critical splice donor site probably null
IGL03182:Aox3 APN 1 58165887 missense probably benign 0.02
IGL03234:Aox3 APN 1 58152686 missense probably benign
IGL03374:Aox3 APN 1 58171848 missense probably damaging 1.00
amber UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0135:Aox3 UTSW 1 58125088 splice site probably benign
R0332:Aox3 UTSW 1 58142751 missense probably benign 0.00
R0626:Aox3 UTSW 1 58172299 missense possibly damaging 0.94
R1325:Aox3 UTSW 1 58176567 nonsense probably null
R1435:Aox3 UTSW 1 58163446 critical splice donor site probably null
R1438:Aox3 UTSW 1 58153178 missense probably benign
R1567:Aox3 UTSW 1 58194693 missense probably damaging 0.96
R1575:Aox3 UTSW 1 58152554 missense probably benign 0.04
R1759:Aox3 UTSW 1 58170646 splice site probably null
R1785:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1786:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1921:Aox3 UTSW 1 58180651 missense probably damaging 1.00
R1984:Aox3 UTSW 1 58153061 missense possibly damaging 0.88
R2012:Aox3 UTSW 1 58138232 missense probably benign 0.02
R2080:Aox3 UTSW 1 58186280 missense probably benign 0.06
R2121:Aox3 UTSW 1 58152549 splice site probably benign
R2126:Aox3 UTSW 1 58158216 missense probably benign 0.25
R2130:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2131:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2132:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2133:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2385:Aox3 UTSW 1 58138289 missense probably damaging 1.00
R2495:Aox3 UTSW 1 58188408 missense probably damaging 0.99
R4200:Aox3 UTSW 1 58188378 missense probably damaging 1.00
R4231:Aox3 UTSW 1 58114885 missense probably benign 0.12
R4591:Aox3 UTSW 1 58152656 missense probably damaging 0.99
R4627:Aox3 UTSW 1 58125035 missense probably damaging 0.98
R4831:Aox3 UTSW 1 58152566 missense probably damaging 0.97
R4864:Aox3 UTSW 1 58176487 missense probably damaging 1.00
R4976:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5007:Aox3 UTSW 1 58163424 missense probably benign
R5119:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5175:Aox3 UTSW 1 58172328 missense probably benign 0.01
R5360:Aox3 UTSW 1 58146508 missense probably damaging 1.00
R5784:Aox3 UTSW 1 58153499 missense probably benign 0.00
R6050:Aox3 UTSW 1 58180655 missense possibly damaging 0.93
R6056:Aox3 UTSW 1 58169859 missense probably damaging 1.00
R6162:Aox3 UTSW 1 58159731 missense possibly damaging 0.75
R6181:Aox3 UTSW 1 58158946 missense probably benign 0.03
R6374:Aox3 UTSW 1 58172161 missense probably benign 0.11
R6662:Aox3 UTSW 1 58118615 missense probably damaging 1.00
R6809:Aox3 UTSW 1 58118681 missense probably damaging 0.99
R6810:Aox3 UTSW 1 58141431 missense probably benign 0.00
R6821:Aox3 UTSW 1 58150388 missense probably benign 0.04
R7039:Aox3 UTSW 1 58176555 missense probably damaging 1.00
R7116:Aox3 UTSW 1 58153530 missense probably benign 0.01
R7146:Aox3 UTSW 1 58158529 splice site probably null
R7163:Aox3 UTSW 1 58119512 missense probably damaging 0.99
R7243:Aox3 UTSW 1 58138307 missense unknown
R7319:Aox3 UTSW 1 58152602 missense probably benign 0.04
R7423:Aox3 UTSW 1 58121069 missense possibly damaging 0.80
R7664:Aox3 UTSW 1 58119539 missense probably damaging 1.00
R7709:Aox3 UTSW 1 58180651 missense probably damaging 1.00
R7745:Aox3 UTSW 1 58176517 missense possibly damaging 0.75
R7751:Aox3 UTSW 1 58179335 missense probably benign 0.11
R7912:Aox3 UTSW 1 58142696 missense probably benign 0.05
R8143:Aox3 UTSW 1 58158915 missense probably benign 0.05
R8178:Aox3 UTSW 1 58150322 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TCCAGAGGGAGTCACTCATG -3'
(R):5'- CAGGATGCTAATACAGTCTTTCTCC -3'

Sequencing Primer
(F):5'- CATGTAAAAGAAAGACAGCCTTTGC -3'
(R):5'- GAGCATGCTAATCAAGTGCTC -3'
Posted On2020-09-15