Incidental Mutation 'R7940:Elf3'
ID 648977
Institutional Source Beutler Lab
Gene Symbol Elf3
Ensembl Gene ENSMUSG00000003051
Gene Name E74-like factor 3
Synonyms ESE-1, jen, ESX
MMRRC Submission 045986-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.925) question?
Stock # R7940 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 135181312-135186210 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 135184866 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 107 (S107C)
Ref Sequence ENSEMBL: ENSMUSP00000003135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003135] [ENSMUST00000185752]
AlphaFold Q3UPW2
PDB Structure Crystal structure of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-beta receptor promoter DNA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000003135
AA Change: S107C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003135
Gene: ENSMUSG00000003051
AA Change: S107C

DomainStartEndE-ValueType
SAM_PNT 67 151 6.32e-30 SMART
low complexity region 230 241 N/A INTRINSIC
AT_hook 264 276 1.29e0 SMART
ETS 292 379 6.11e-49 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185752
AA Change: S87C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139769
Gene: ENSMUSG00000003051
AA Change: S87C

DomainStartEndE-ValueType
SAM_PNT 47 131 1.36e-29 SMART
low complexity region 210 221 N/A INTRINSIC
AT_hook 244 256 1.29e0 SMART
ETS 272 359 6.11e-49 SMART
Meta Mutation Damage Score 0.2290 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: About one third of mice homozygous for a reporter allele die at E11.5; over half of those born develop a wasted phenotype, lethargy and watery diarrhea and die during the first few weeks of life exhibiting dysmorphogenesis and altered differentiation of small intestinal epithelium. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 130,952,767 (GRCm39) M238T probably benign Het
Acacb C T 5: 114,304,108 (GRCm39) S177F possibly damaging Het
Afap1l2 A G 19: 56,902,597 (GRCm39) V822A probably damaging Het
Alpk3 C T 7: 80,743,693 (GRCm39) P1170L probably damaging Het
Aox3 A G 1: 58,227,596 (GRCm39) I1234V probably damaging Het
Ascc1 G A 10: 59,848,381 (GRCm39) V103M probably null Het
Brca2 C G 5: 150,462,198 (GRCm39) T654S probably benign Het
Cblb T C 16: 51,972,899 (GRCm39) F410S probably damaging Het
Cep95 T A 11: 106,686,974 (GRCm39) N94K probably benign Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cpe T A 8: 65,047,945 (GRCm39) S440C probably damaging Het
Cspg4 C T 9: 56,795,381 (GRCm39) Q1039* probably null Het
Cul5 A T 9: 53,535,069 (GRCm39) S612T probably benign Het
Dapl1 T C 2: 59,315,112 (GRCm39) probably null Het
Deptor C T 15: 55,072,244 (GRCm39) T241M probably benign Het
Dnaaf1 A G 8: 120,309,454 (GRCm39) T181A possibly damaging Het
Dnajc11 G T 4: 152,053,045 (GRCm39) Q156H probably benign Het
Dst T C 1: 34,206,757 (GRCm39) V975A possibly damaging Het
Enpp2 T A 15: 54,770,324 (GRCm39) D105V probably damaging Het
Fgd6 G A 10: 93,956,344 (GRCm39) V1008I probably benign Het
Frmpd2 C T 14: 33,276,850 (GRCm39) R1157* probably null Het
Gabrg2 A C 11: 41,858,474 (GRCm39) V218G probably benign Het
Gdpgp1 C T 7: 79,888,953 (GRCm39) A328V probably damaging Het
Glis1 C G 4: 107,489,571 (GRCm39) F719L probably damaging Het
Glis1 A T 4: 107,489,572 (GRCm39) N720Y probably damaging Het
Grin2c G T 11: 115,146,107 (GRCm39) A546D probably damaging Het
Gtf3c5 G A 2: 28,458,592 (GRCm39) T433I possibly damaging Het
Jmjd6 C A 11: 116,734,055 (GRCm39) probably benign Het
Kctd14 T C 7: 97,106,891 (GRCm39) S49P probably damaging Het
Lamc2 T A 1: 153,006,521 (GRCm39) K877* probably null Het
Lgr4 T A 2: 109,836,858 (GRCm39) S397R probably damaging Het
Lrp2 A T 2: 69,262,541 (GRCm39) I4420N possibly damaging Het
Lyn A G 4: 3,783,089 (GRCm39) K441E possibly damaging Het
Minpp1 A T 19: 32,463,359 (GRCm39) S7C possibly damaging Het
Mrps9 T A 1: 42,901,808 (GRCm39) D105E probably damaging Het
Ncoa1 C A 12: 4,363,095 (GRCm39) A247S possibly damaging Het
Or52b4i G A 7: 102,191,515 (GRCm39) R124H possibly damaging Het
Or8c15 T C 9: 38,120,496 (GRCm39) V47A probably benign Het
Pabir1 G A 19: 24,454,552 (GRCm39) R57W probably benign Het
Pakap A G 4: 57,883,026 (GRCm39) K790E probably damaging Het
Pcdh15 G A 10: 74,430,022 (GRCm39) V1250I probably damaging Het
Pcdha12 A T 18: 37,153,409 (GRCm39) T43S probably damaging Het
Pkn2 G A 3: 142,516,480 (GRCm39) R549C probably benign Het
Plscr4 C T 9: 92,372,843 (GRCm39) R322* probably null Het
Polq T A 16: 36,881,004 (GRCm39) M1056K probably benign Het
Ppp1r12b A T 1: 134,803,793 (GRCm39) N455K probably benign Het
Rhbdf1 T A 11: 32,166,258 (GRCm39) M1L possibly damaging Het
Rspry1 G T 8: 95,349,635 (GRCm39) V8L probably benign Het
Slc6a20b A G 9: 123,436,666 (GRCm39) V249A probably damaging Het
Smok2b A T 17: 13,455,046 (GRCm39) H402L possibly damaging Het
Supt20 A T 3: 54,620,620 (GRCm39) N393I probably benign Het
Tcp11l1 T C 2: 104,528,993 (GRCm39) K102E probably damaging Het
Tpbgl T C 7: 99,274,798 (GRCm39) Y353C probably damaging Het
Usp24 A T 4: 106,287,741 (GRCm39) Q2465L probably damaging Het
Vmn2r116 T A 17: 23,605,946 (GRCm39) M286K probably damaging Het
Wnt16 C A 6: 22,291,188 (GRCm39) N205K possibly damaging Het
Xkr7 C A 2: 152,874,135 (GRCm39) F67L probably damaging Het
Zfp473 T G 7: 44,384,000 (GRCm39) E111A probably damaging Het
Zfp74 T C 7: 29,631,867 (GRCm39) K126E probably benign Het
Other mutations in Elf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Elf3 APN 1 135,185,445 (GRCm39) missense possibly damaging 0.94
IGL02470:Elf3 APN 1 135,182,750 (GRCm39) missense probably damaging 1.00
IGL03018:Elf3 APN 1 135,183,803 (GRCm39) missense possibly damaging 0.62
IGL03252:Elf3 APN 1 135,182,691 (GRCm39) missense probably damaging 1.00
P0026:Elf3 UTSW 1 135,183,711 (GRCm39) critical splice donor site probably null
R0087:Elf3 UTSW 1 135,184,875 (GRCm39) missense probably damaging 1.00
R1842:Elf3 UTSW 1 135,184,531 (GRCm39) missense possibly damaging 0.65
R1897:Elf3 UTSW 1 135,184,875 (GRCm39) missense probably damaging 1.00
R2081:Elf3 UTSW 1 135,184,814 (GRCm39) missense probably benign 0.12
R4049:Elf3 UTSW 1 135,182,015 (GRCm39) missense probably benign 0.21
R4467:Elf3 UTSW 1 135,184,582 (GRCm39) missense probably damaging 1.00
R4630:Elf3 UTSW 1 135,184,478 (GRCm39) intron probably benign
R4715:Elf3 UTSW 1 135,185,490 (GRCm39) missense probably damaging 1.00
R4923:Elf3 UTSW 1 135,184,473 (GRCm39) intron probably benign
R5226:Elf3 UTSW 1 135,184,977 (GRCm39) missense probably benign 0.07
R5422:Elf3 UTSW 1 135,182,778 (GRCm39) missense probably damaging 0.98
R5706:Elf3 UTSW 1 135,184,220 (GRCm39) missense probably benign 0.01
R7115:Elf3 UTSW 1 135,184,856 (GRCm39) missense probably damaging 1.00
R7644:Elf3 UTSW 1 135,184,244 (GRCm39) missense possibly damaging 0.89
R7855:Elf3 UTSW 1 135,182,090 (GRCm39) missense probably damaging 1.00
R8315:Elf3 UTSW 1 135,184,314 (GRCm39) missense probably benign 0.00
R8723:Elf3 UTSW 1 135,185,385 (GRCm39) missense possibly damaging 0.95
R8724:Elf3 UTSW 1 135,182,098 (GRCm39) missense probably damaging 1.00
R8906:Elf3 UTSW 1 135,182,678 (GRCm39) missense probably damaging 1.00
R8960:Elf3 UTSW 1 135,182,813 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATCAGAAGAGTTGGAGGCTG -3'
(R):5'- GGTTGTGTAGGACCTCAGAC -3'

Sequencing Primer
(F):5'- AGAGCGTCACTGACCATGGTTC -3'
(R):5'- TTGTGTAGGACCTCAGACAAGATCC -3'
Posted On 2020-09-15