Mutagenetix > Incidental Mutation

Incidental Mutation 'R7940:Elf3'

648977

Institutional Source

Beutler Lab

Gene Symbol

Elf3

Ensembl Gene

ENSMUSG00000003051

Gene Name

E74-like factor 3

Synonyms

ESX, jen, ESE-1

MMRRC Submission

045986-MU

Accession Numbers

Ncbi RefSeq: NM_001163131.1, NM_007921.3; MGI:1101781

Essential gene?

Probably essential (E-score: 0.917) question?

Stock #

R7940 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135253575-135258568 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 135257128 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 107 (S107C)

Ref Sequence

ENSEMBL: ENSMUSP00000003135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003135] [ENSMUST00000185752]

AlphaFold

Q3UPW2

PDB Structure

Crystal structure of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-beta receptor promoter DNA [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000003135
AA Change: S107C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000003135
Gene: ENSMUSG00000003051
AA Change: S107C

Domain	Start	End	E-Value	Type
SAM_PNT	67	151	6.32e-30	SMART
low complexity region	230	241	N/A	INTRINSIC
AT_hook	264	276	1.29e0	SMART
ETS	292	379	6.11e-49	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000185752
AA Change: S87C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000139769
Gene: ENSMUSG00000003051
AA Change: S87C

Domain	Start	End	E-Value	Type
SAM_PNT	47	131	1.36e-29	SMART
low complexity region	210	221	N/A	INTRINSIC
AT_hook	244	256	1.29e0	SMART
ETS	272	359	6.11e-49	SMART

Meta Mutation Damage Score

0.2290

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (56/57)

MGI Phenotype

Strain: 2662485
Lethality: D11-D21
PHENOTYPE: About one third of mice homozygous for a reporter allele die at E11.5; over half of those born develop a wasted phenotype, lethargy and watery diarrhea and die during the first few weeks of life exhibiting dysmorphogenesis and altered differentiation of small intestinal epithelium. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	A	G	7: 131,351,038	M238T	probably benign	Het
Acacb	C	T	5: 114,166,047	S177F	possibly damaging	Het
Afap1l2	A	G	19: 56,914,165	V822A	probably damaging	Het
Akap2	A	G	4: 57,883,026	K790E	probably damaging	Het
Alpk3	C	T	7: 81,093,945	P1170L	probably damaging	Het
Aox3	A	G	1: 58,188,437	I1234V	probably damaging	Het
Ascc1	G	A	10: 60,012,559	V103M	probably null	Het
Brca2	C	G	5: 150,538,733	T654S	probably benign	Het
Cblb	T	C	16: 52,152,536	F410S	probably damaging	Het
Cep95	T	A	11: 106,796,148	N94K	probably benign	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cpe	T	A	8: 64,594,911	S440C	probably damaging	Het
Cspg4	C	T	9: 56,888,097	Q1039*	probably null	Het
Cul5	A	T	9: 53,623,769	S612T	probably benign	Het
Dapl1	T	C	2: 59,484,768		probably null	Het
Deptor	C	T	15: 55,208,848	T241M	probably benign	Het
Dnaaf1	A	G	8: 119,582,715	T181A	possibly damaging	Het
Dnajc11	G	T	4: 151,968,588	Q156H	probably benign	Het
Dst	T	C	1: 34,167,676	V975A	possibly damaging	Het
Enpp2	T	A	15: 54,906,928	D105V	probably damaging	Het
Fam122a	G	A	19: 24,477,188	R57W	probably benign	Het
Fgd6	G	A	10: 94,120,482	V1008I	probably benign	Het
Frmpd2	C	T	14: 33,554,893	R1157*	probably null	Het
Gabrg2	A	C	11: 41,967,647	V218G	probably benign	Het
Gdpgp1	C	T	7: 80,239,205	A328V	probably damaging	Het
Glis1	C	G	4: 107,632,374	F719L	probably damaging	Het
Glis1	A	T	4: 107,632,375	N720Y	probably damaging	Het
Grin2c	G	T	11: 115,255,281	A546D	probably damaging	Het
Gtf3c5	G	A	2: 28,568,580	T433I	possibly damaging	Het
Jmjd6	C	A	11: 116,843,229		probably benign	Het
Kctd14	T	C	7: 97,457,684	S49P	probably damaging	Het
Lamc2	T	A	1: 153,130,775	K877*	probably null	Het
Lgr4	T	A	2: 110,006,513	S397R	probably damaging	Het
Lrp2	A	T	2: 69,432,197	I4420N	possibly damaging	Het
Lyn	A	G	4: 3,783,089	K441E	possibly damaging	Het
Minpp1	A	T	19: 32,485,959	S7C	possibly damaging	Het
Mrps9	T	A	1: 42,862,648	D105E	probably damaging	Het
Ncoa1	C	A	12: 4,313,095	A247S	possibly damaging	Het
Olfr548-ps1	G	A	7: 102,542,308	R124H	possibly damaging	Het
Olfr893	T	C	9: 38,209,200	V47A	probably benign	Het
Pcdh15	G	A	10: 74,594,190	V1250I	probably damaging	Het
Pcdha12	A	T	18: 37,020,356	T43S	probably damaging	Het
Pkn2	G	A	3: 142,810,719	R549C	probably benign	Het
Plscr4	C	T	9: 92,490,790	R322*	probably null	Het
Polq	T	A	16: 37,060,642	M1056K	probably benign	Het
Ppp1r12b	A	T	1: 134,876,055	N455K	probably benign	Het
Rhbdf1	T	A	11: 32,216,258	M1L	possibly damaging	Het
Rspry1	G	T	8: 94,623,007	V8L	probably benign	Het
Slc6a20b	A	G	9: 123,607,601	V249A	probably damaging	Het
Smok2b	A	T	17: 13,236,159	H402L	possibly damaging	Het
Supt20	A	T	3: 54,713,199	N393I	probably benign	Het
Tcp11l1	T	C	2: 104,698,648	K102E	probably damaging	Het
Tpbgl	T	C	7: 99,625,591	Y353C	probably damaging	Het
Usp24	A	T	4: 106,430,544	Q2465L	probably damaging	Het
Vmn2r116	T	A	17: 23,386,972	M286K	probably damaging	Het
Wnt16	C	A	6: 22,291,189	N205K	possibly damaging	Het
Xkr7	C	A	2: 153,032,215	F67L	probably damaging	Het
Zfp473	T	G	7: 44,734,576	E111A	probably damaging	Het
Zfp74	T	C	7: 29,932,442	K126E	probably benign	Het

Other mutations in Elf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02141:Elf3	APN	1	135257707	missense	possibly damaging	0.94
IGL02470:Elf3	APN	1	135255012	missense	probably damaging	1.00
IGL03018:Elf3	APN	1	135256065	missense	possibly damaging	0.62
IGL03252:Elf3	APN	1	135254953	missense	probably damaging	1.00
P0026:Elf3	UTSW	1	135255973	critical splice donor site	probably null
R0087:Elf3	UTSW	1	135257137	missense	probably damaging	1.00
R1842:Elf3	UTSW	1	135256793	missense	possibly damaging	0.65
R1897:Elf3	UTSW	1	135257137	missense	probably damaging	1.00
R2081:Elf3	UTSW	1	135257076	missense	probably benign	0.12
R4049:Elf3	UTSW	1	135254277	missense	probably benign	0.21
R4467:Elf3	UTSW	1	135256844	missense	probably damaging	1.00
R4630:Elf3	UTSW	1	135256740	intron	probably benign
R4715:Elf3	UTSW	1	135257752	missense	probably damaging	1.00
R4923:Elf3	UTSW	1	135256735	intron	probably benign
R5226:Elf3	UTSW	1	135257239	missense	probably benign	0.07
R5422:Elf3	UTSW	1	135255040	missense	probably damaging	0.98
R5706:Elf3	UTSW	1	135256482	missense	probably benign	0.01
R7115:Elf3	UTSW	1	135257118	missense	probably damaging	1.00
R7644:Elf3	UTSW	1	135256506	missense	possibly damaging	0.89
R7855:Elf3	UTSW	1	135254352	missense	probably damaging	1.00
R8315:Elf3	UTSW	1	135256576	missense	probably benign	0.00
R8723:Elf3	UTSW	1	135257647	missense	possibly damaging	0.95
R8724:Elf3	UTSW	1	135254360	missense	probably damaging	1.00
R8906:Elf3	UTSW	1	135254940	missense	probably damaging	1.00
R8960:Elf3	UTSW	1	135255075	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCATCAGAAGAGTTGGAGGCTG -3'
(R):5'- GGTTGTGTAGGACCTCAGAC -3'

Sequencing Primer
(F):5'- AGAGCGTCACTGACCATGGTTC -3'
(R):5'- TTGTGTAGGACCTCAGACAAGATCC -3'

Posted On

2020-09-15