Mutagenetix > Incidental Mutation

Incidental Mutation 'R7940:Lgr4'

648983

Institutional Source

Beutler Lab

Gene Symbol

Lgr4

Ensembl Gene

ENSMUSG00000050199

Gene Name

leucine-rich repeat-containing G protein-coupled receptor 4

Synonyms

A930009A08Rik, Gpr48, A330106J01Rik

MMRRC Submission

045986-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7940 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

109917647-110014257 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110006513 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 397 (S397R)

Ref Sequence

ENSEMBL: ENSMUSP00000047325 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046548] [ENSMUST00000111037]

AlphaFold

A2ARI4

Predicted Effect

probably damaging
Transcript: ENSMUST00000046548
AA Change: S397R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000047325
Gene: ENSMUSG00000050199
AA Change: S397R

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
LRRNT	28	61	6.68e-6	SMART
LRR	55	79	1.49e1	SMART
LRR	80	103	1.99e0	SMART
LRR_TYP	104	127	2.75e-3	SMART
LRR_TYP	128	151	2.79e-4	SMART
LRR	152	175	2.54e1	SMART
LRR	176	199	4.65e-1	SMART
LRR_TYP	200	223	1.04e-3	SMART
LRR	224	246	6.4e0	SMART
LRR_TYP	247	270	5.99e-4	SMART
LRR	272	294	9.77e1	SMART
LRR	318	341	3e1	SMART
LRR	343	363	4.71e1	SMART
LRR	364	387	1.49e1	SMART
LRR_TYP	388	411	1.15e-5	SMART
LRR	412	435	3.98e1	SMART
low complexity region	500	516	N/A	INTRINSIC
Pfam:7tm_1	555	801	2.7e-10	PFAM
low complexity region	824	837	N/A	INTRINSIC
low complexity region	910	924	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111037
AA Change: S373R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106666
Gene: ENSMUSG00000050199
AA Change: S373R

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
LRRNT	28	61	6.68e-6	SMART
LRR	55	79	9.77e1	SMART
LRR_TYP	80	103	2.75e-3	SMART
LRR_TYP	104	127	2.79e-4	SMART
LRR	128	151	2.54e1	SMART
LRR	152	175	4.65e-1	SMART
LRR_TYP	176	199	1.04e-3	SMART
LRR	200	222	6.4e0	SMART
LRR_TYP	223	246	5.99e-4	SMART
LRR	248	270	9.77e1	SMART
LRR	294	317	3e1	SMART
LRR	319	339	4.71e1	SMART
LRR	340	363	1.49e1	SMART
LRR_TYP	364	387	1.15e-5	SMART
LRR	388	411	3.98e1	SMART
low complexity region	476	492	N/A	INTRINSIC
Pfam:7tm_1	531	777	9.3e-17	PFAM
low complexity region	800	813	N/A	INTRINSIC
low complexity region	886	900	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor that binds R-spondins and activates the Wnt signaling pathway. This Wnt signaling pathway activation is necessary for proper development of many organs of the body. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a knock-out allele show embryonic and perinatal death, open eyelids, and abnormal renal development. One gene trap mutation leads to reduced body weight, sterility, and impaired male reproductive tract development. Another gene trap mutation causes ocular anterior segment anomalies. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	A	G	7: 131,351,038	M238T	probably benign	Het
Acacb	C	T	5: 114,166,047	S177F	possibly damaging	Het
Afap1l2	A	G	19: 56,914,165	V822A	probably damaging	Het
Akap2	A	G	4: 57,883,026	K790E	probably damaging	Het
Alpk3	C	T	7: 81,093,945	P1170L	probably damaging	Het
Aox3	A	G	1: 58,188,437	I1234V	probably damaging	Het
Ascc1	G	A	10: 60,012,559	V103M	probably null	Het
Brca2	C	G	5: 150,538,733	T654S	probably benign	Het
Cblb	T	C	16: 52,152,536	F410S	probably damaging	Het
Cep95	T	A	11: 106,796,148	N94K	probably benign	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cpe	T	A	8: 64,594,911	S440C	probably damaging	Het
Cspg4	C	T	9: 56,888,097	Q1039*	probably null	Het
Cul5	A	T	9: 53,623,769	S612T	probably benign	Het
Dapl1	T	C	2: 59,484,768		probably null	Het
Deptor	C	T	15: 55,208,848	T241M	probably benign	Het
Dnaaf1	A	G	8: 119,582,715	T181A	possibly damaging	Het
Dnajc11	G	T	4: 151,968,588	Q156H	probably benign	Het
Dst	T	C	1: 34,167,676	V975A	possibly damaging	Het
Elf3	T	A	1: 135,257,128	S107C	probably damaging	Het
Enpp2	T	A	15: 54,906,928	D105V	probably damaging	Het
Fam122a	G	A	19: 24,477,188	R57W	probably benign	Het
Fgd6	G	A	10: 94,120,482	V1008I	probably benign	Het
Frmpd2	C	T	14: 33,554,893	R1157*	probably null	Het
Gabrg2	A	C	11: 41,967,647	V218G	probably benign	Het
Gdpgp1	C	T	7: 80,239,205	A328V	probably damaging	Het
Glis1	C	G	4: 107,632,374	F719L	probably damaging	Het
Glis1	A	T	4: 107,632,375	N720Y	probably damaging	Het
Grin2c	G	T	11: 115,255,281	A546D	probably damaging	Het
Gtf3c5	G	A	2: 28,568,580	T433I	possibly damaging	Het
Jmjd6	C	A	11: 116,843,229		probably benign	Het
Kctd14	T	C	7: 97,457,684	S49P	probably damaging	Het
Lamc2	T	A	1: 153,130,775	K877*	probably null	Het
Lrp2	A	T	2: 69,432,197	I4420N	possibly damaging	Het
Lyn	A	G	4: 3,783,089	K441E	possibly damaging	Het
Minpp1	A	T	19: 32,485,959	S7C	possibly damaging	Het
Mrps9	T	A	1: 42,862,648	D105E	probably damaging	Het
Ncoa1	C	A	12: 4,313,095	A247S	possibly damaging	Het
Olfr548-ps1	G	A	7: 102,542,308	R124H	possibly damaging	Het
Olfr893	T	C	9: 38,209,200	V47A	probably benign	Het
Pcdh15	G	A	10: 74,594,190	V1250I	probably damaging	Het
Pcdha12	A	T	18: 37,020,356	T43S	probably damaging	Het
Pkn2	G	A	3: 142,810,719	R549C	probably benign	Het
Plscr4	C	T	9: 92,490,790	R322*	probably null	Het
Polq	T	A	16: 37,060,642	M1056K	probably benign	Het
Ppp1r12b	A	T	1: 134,876,055	N455K	probably benign	Het
Rhbdf1	T	A	11: 32,216,258	M1L	possibly damaging	Het
Rspry1	G	T	8: 94,623,007	V8L	probably benign	Het
Slc6a20b	A	G	9: 123,607,601	V249A	probably damaging	Het
Smok2b	A	T	17: 13,236,159	H402L	possibly damaging	Het
Supt20	A	T	3: 54,713,199	N393I	probably benign	Het
Tcp11l1	T	C	2: 104,698,648	K102E	probably damaging	Het
Tpbgl	T	C	7: 99,625,591	Y353C	probably damaging	Het
Usp24	A	T	4: 106,430,544	Q2465L	probably damaging	Het
Vmn2r116	T	A	17: 23,386,972	M286K	probably damaging	Het
Wnt16	C	A	6: 22,291,189	N205K	possibly damaging	Het
Xkr7	C	A	2: 153,032,215	F67L	probably damaging	Het
Zfp473	T	G	7: 44,734,576	E111A	probably damaging	Het
Zfp74	T	C	7: 29,932,442	K126E	probably benign	Het

Other mutations in Lgr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02043:Lgr4	APN	2	110011290	missense	probably damaging	1.00
IGL02247:Lgr4	APN	2	110002501	missense	probably benign
IGL02247:Lgr4	APN	2	110008075	splice site	probably benign
IGL02302:Lgr4	APN	2	110002496	missense	probably damaging	0.99
IGL02309:Lgr4	APN	2	110012535	utr 3 prime	probably benign
IGL02511:Lgr4	APN	2	110011272	missense	probably benign	0.06
IGL02604:Lgr4	APN	2	110011313	missense	probably damaging	1.00
IGL02648:Lgr4	APN	2	110012373	missense	probably damaging	1.00
IGL02795:Lgr4	APN	2	110008210	splice site	probably benign
IGL02899:Lgr4	APN	2	109918253	missense	probably damaging	0.99
R0003:Lgr4	UTSW	2	109997665	critical splice donor site	probably null
R0200:Lgr4	UTSW	2	109970690	critical splice acceptor site	probably null
R0314:Lgr4	UTSW	2	109991093	splice site	probably benign
R0482:Lgr4	UTSW	2	110008092	missense	probably damaging	1.00
R0491:Lgr4	UTSW	2	110007281	splice site	probably benign
R0517:Lgr4	UTSW	2	110011320	missense	probably damaging	1.00
R0546:Lgr4	UTSW	2	109999421	missense	probably damaging	0.98
R0658:Lgr4	UTSW	2	110011787	missense	possibly damaging	0.83
R1367:Lgr4	UTSW	2	109991135	missense	probably damaging	0.98
R1864:Lgr4	UTSW	2	110011397	missense	possibly damaging	0.93
R1977:Lgr4	UTSW	2	110011928	missense	probably damaging	1.00
R2239:Lgr4	UTSW	2	110012393	missense	probably damaging	1.00
R2380:Lgr4	UTSW	2	110012393	missense	probably damaging	1.00
R2383:Lgr4	UTSW	2	110000615	missense	probably damaging	1.00
R2997:Lgr4	UTSW	2	110003517	missense	probably benign	0.30
R3707:Lgr4	UTSW	2	109970754	missense	probably damaging	0.99
R3803:Lgr4	UTSW	2	110008197	missense	probably benign	0.10
R3804:Lgr4	UTSW	2	110008197	missense	probably benign	0.10
R3843:Lgr4	UTSW	2	109996773	splice site	probably benign
R4030:Lgr4	UTSW	2	109989751	missense	probably benign	0.06
R4513:Lgr4	UTSW	2	110012016	missense	possibly damaging	0.93
R4777:Lgr4	UTSW	2	109996682	missense	probably damaging	0.98
R4912:Lgr4	UTSW	2	110006502	critical splice acceptor site	probably null
R4994:Lgr4	UTSW	2	110011938	missense	probably damaging	0.99
R5106:Lgr4	UTSW	2	109997595	missense	probably damaging	0.97
R5131:Lgr4	UTSW	2	110012333	missense	probably benign
R5152:Lgr4	UTSW	2	110000603	missense	probably damaging	1.00
R5753:Lgr4	UTSW	2	110002512	nonsense	probably null
R5860:Lgr4	UTSW	2	109991151	missense	probably damaging	0.96
R5914:Lgr4	UTSW	2	109918272	missense	possibly damaging	0.78
R6145:Lgr4	UTSW	2	110007243	nonsense	probably null
R6263:Lgr4	UTSW	2	110011898	missense	possibly damaging	0.95
R6400:Lgr4	UTSW	2	109991133	missense	probably damaging	0.98
R6924:Lgr4	UTSW	2	110012439	missense	probably damaging	1.00
R7171:Lgr4	UTSW	2	110000969	missense	probably benign	0.11
R7326:Lgr4	UTSW	2	109996629	nonsense	probably null
R7593:Lgr4	UTSW	2	109999456	missense	probably damaging	1.00
R7659:Lgr4	UTSW	2	109996766	missense	probably damaging	1.00
R7707:Lgr4	UTSW	2	109997591	critical splice acceptor site	probably null
R7936:Lgr4	UTSW	2	110006518	missense	probably damaging	1.00
R8062:Lgr4	UTSW	2	110000937	missense	probably damaging	1.00
R8153:Lgr4	UTSW	2	110000300	missense	probably damaging	0.99
R9225:Lgr4	UTSW	2	110012140	missense	probably benign
R9434:Lgr4	UTSW	2	110006562	missense	probably benign
R9557:Lgr4	UTSW	2	109996739	missense	probably damaging	1.00
X0053:Lgr4	UTSW	2	110011437	missense	possibly damaging	0.52

Predicted Primers

PCR Primer
(F):5'- GATGCGAGCTACAATTACTACTACAG -3'
(R):5'- AGGTCTTGACAACTGAGAAGC -3'

Sequencing Primer
(F):5'- GAGCTACAATTACTACTACAGGGAAC -3'
(R):5'- GGTCTTGACAACTGAGAAGCTATTAC -3'

Posted On

2020-09-15