Incidental Mutation 'R7940:Lyn'
ID648988
Institutional Source Beutler Lab
Gene Symbol Lyn
Ensembl Gene ENSMUSG00000042228
Gene NameLYN proto-oncogene, Src family tyrosine kinase
SynonymsHck-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7940 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location3678115-3813122 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3783089 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 441 (K441E)
Ref Sequence ENSEMBL: ENSMUSP00000038838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041377] [ENSMUST00000103010]
PDB Structure Lyn Tyrosine Kinase Domain, apo form [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-AMP-PNP complex [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-PP2 complex [X-RAY DIFFRACTION]
Lyn Tyrosine Kinase Domain-Dasatinib complex [X-RAY DIFFRACTION]
Structure of unliganded Lyn SH2 domain [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041377
AA Change: K441E

PolyPhen 2 Score 0.735 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038838
Gene: ENSMUSG00000042228
AA Change: K441E

DomainStartEndE-ValueType
SH3 66 122 9.24e-21 SMART
SH2 127 217 5.38e-33 SMART
TyrKc 247 497 3.25e-137 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103010
AA Change: K420E

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000100075
Gene: ENSMUSG00000042228
AA Change: K420E

DomainStartEndE-ValueType
SH3 45 101 5.8e-23 SMART
SH2 106 196 3.3e-35 SMART
TyrKc 226 476 1.6e-139 SMART
Meta Mutation Damage Score 0.3324 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine protein kinase, which maybe involved in the regulation of mast cell degranulation, and erythroid differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit splenomegaly, reduced numbers of peripheral B cells, impaired immune responses, IgM hyperglobulinemia, autoimmunity with glomerulonephritis, and monocyte/macrophage tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 131,351,038 M238T probably benign Het
Acacb C T 5: 114,166,047 S177F possibly damaging Het
Afap1l2 A G 19: 56,914,165 V822A probably damaging Het
Akap2 A G 4: 57,883,026 K790E probably damaging Het
Alpk3 C T 7: 81,093,945 P1170L probably damaging Het
Aox3 A G 1: 58,188,437 I1234V probably damaging Het
Ascc1 G A 10: 60,012,559 V103M probably null Het
Brca2 C G 5: 150,538,733 T654S probably benign Het
Cblb T C 16: 52,152,536 F410S probably damaging Het
Cep95 T A 11: 106,796,148 N94K probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cpe T A 8: 64,594,911 S440C probably damaging Het
Cspg4 C T 9: 56,888,097 Q1039* probably null Het
Cul5 A T 9: 53,623,769 S612T probably benign Het
Dapl1 T C 2: 59,484,768 probably null Het
Deptor C T 15: 55,208,848 T241M probably benign Het
Dnaaf1 A G 8: 119,582,715 T181A possibly damaging Het
Dnajc11 G T 4: 151,968,588 Q156H probably benign Het
Dst T C 1: 34,167,676 V975A possibly damaging Het
Elf3 T A 1: 135,257,128 S107C probably damaging Het
Enpp2 T A 15: 54,906,928 D105V probably damaging Het
Fam122a G A 19: 24,477,188 R57W probably benign Het
Fgd6 G A 10: 94,120,482 V1008I probably benign Het
Frmpd2 C T 14: 33,554,893 R1157* probably null Het
Gabrg2 A C 11: 41,967,647 V218G probably benign Het
Gdpgp1 C T 7: 80,239,205 A328V probably damaging Het
Glis1 C G 4: 107,632,374 F719L probably damaging Het
Glis1 A T 4: 107,632,375 N720Y probably damaging Het
Grin2c G T 11: 115,255,281 A546D probably damaging Het
Gtf3c5 G A 2: 28,568,580 T433I possibly damaging Het
Jmjd6 C A 11: 116,843,229 probably benign Het
Kctd14 T C 7: 97,457,684 S49P probably damaging Het
Lamc2 T A 1: 153,130,775 K877* probably null Het
Lgr4 T A 2: 110,006,513 S397R probably damaging Het
Lrp2 A T 2: 69,432,197 I4420N possibly damaging Het
Minpp1 A T 19: 32,485,959 S7C possibly damaging Het
Mrps9 T A 1: 42,862,648 D105E probably damaging Het
Ncoa1 C A 12: 4,313,095 A247S possibly damaging Het
Olfr548-ps1 G A 7: 102,542,308 R124H possibly damaging Het
Olfr893 T C 9: 38,209,200 V47A probably benign Het
Pcdh15 G A 10: 74,594,190 V1250I probably damaging Het
Pcdha12 A T 18: 37,020,356 T43S probably damaging Het
Pkn2 G A 3: 142,810,719 R549C probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Polq T A 16: 37,060,642 M1056K probably benign Het
Ppp1r12b A T 1: 134,876,055 N455K probably benign Het
Rhbdf1 T A 11: 32,216,258 M1L possibly damaging Het
Rspry1 G T 8: 94,623,007 V8L probably benign Het
Slc6a20b A G 9: 123,607,601 V249A probably damaging Het
Smok2b A T 17: 13,236,159 H402L possibly damaging Het
Supt20 A T 3: 54,713,199 N393I probably benign Het
Tcp11l1 T C 2: 104,698,648 K102E probably damaging Het
Tpbgl T C 7: 99,625,591 Y353C probably damaging Het
Usp24 A T 4: 106,430,544 Q2465L probably damaging Het
Vmn2r116 T A 17: 23,386,972 M286K probably damaging Het
Wnt16 C A 6: 22,291,189 N205K possibly damaging Het
Xkr7 C A 2: 153,032,215 F67L probably damaging Het
Zfp473 T G 7: 44,734,576 E111A probably damaging Het
Zfp74 T C 7: 29,932,442 K126E probably benign Het
Other mutations in Lyn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01752:Lyn APN 4 3743286 missense probably benign
IGL02744:Lyn APN 4 3738808 missense probably benign 0.00
IGL02860:Lyn APN 4 3745594 missense possibly damaging 0.77
IGL03328:Lyn APN 4 3745327 missense probably benign 0.01
IGL03370:Lyn APN 4 3780931 missense possibly damaging 0.81
Cress UTSW 4 3789908 nonsense probably null
Friede UTSW 4 3789834 nonsense probably null
Kohlrabi UTSW 4 3783089 missense possibly damaging 0.74
lechuga UTSW 4 3783050 missense probably damaging 1.00
Lemon UTSW 4 3746768 missense probably damaging 1.00
Pacific UTSW 4 3745330 missense probably damaging 1.00
R1615_Lyn_036 UTSW 4 3748765 missense probably benign 0.11
water UTSW 4 3748787 missense possibly damaging 0.93
R0079:Lyn UTSW 4 3746768 missense probably damaging 1.00
R0089:Lyn UTSW 4 3748768 missense probably benign 0.23
R0582:Lyn UTSW 4 3743296 missense probably damaging 1.00
R0747:Lyn UTSW 4 3745638 splice site probably benign
R1460:Lyn UTSW 4 3789908 nonsense probably null
R1615:Lyn UTSW 4 3748765 missense probably benign 0.11
R1654:Lyn UTSW 4 3789912 missense probably damaging 0.99
R1703:Lyn UTSW 4 3738867 splice site probably null
R2301:Lyn UTSW 4 3780959 missense probably damaging 1.00
R2421:Lyn UTSW 4 3748787 missense possibly damaging 0.93
R2512:Lyn UTSW 4 3745542 missense probably benign 0.01
R3418:Lyn UTSW 4 3746833 missense probably damaging 0.97
R3419:Lyn UTSW 4 3746833 missense probably damaging 0.97
R3701:Lyn UTSW 4 3742455 missense probably benign
R3702:Lyn UTSW 4 3742455 missense probably benign
R3736:Lyn UTSW 4 3745330 missense probably damaging 1.00
R4350:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4351:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4352:Lyn UTSW 4 3789796 missense probably damaging 0.99
R4649:Lyn UTSW 4 3738850 missense probably benign
R5738:Lyn UTSW 4 3782987 missense probably damaging 1.00
R5875:Lyn UTSW 4 3745631 splice site probably null
R6375:Lyn UTSW 4 3745527 missense probably damaging 1.00
R7029:Lyn UTSW 4 3782996 missense probably damaging 0.98
R7621:Lyn UTSW 4 3789834 nonsense probably null
R7726:Lyn UTSW 4 3756428 nonsense probably null
R8169:Lyn UTSW 4 3783050 missense probably damaging 1.00
R8341:Lyn UTSW 4 3743304 critical splice donor site probably null
R8782:Lyn UTSW 4 3783055 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCATAACCCATCATTAGCTTGAAC -3'
(R):5'- GGGCACTAGTGTCTAATCTGC -3'

Sequencing Primer
(F):5'- TTGAACTCTGAGTAGGAGCCCAC -3'
(R):5'- AGTGTCTAATCTGCCTCACTGAAAC -3'
Posted On2020-09-15