Incidental Mutation 'R7940:Glis1'
ID 648992
Institutional Source Beutler Lab
Gene Symbol Glis1
Ensembl Gene ENSMUSG00000034762
Gene Name GLIS family zinc finger 1
Synonyms GliH1
MMRRC Submission 045986-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7940 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 107291788-107492258 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 107489572 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 720 (N720Y)
Ref Sequence ENSEMBL: ENSMUSP00000035650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046005] [ENSMUST00000106738]
AlphaFold Q8K1M4
Predicted Effect probably damaging
Transcript: ENSMUST00000046005
AA Change: N720Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035650
Gene: ENSMUSG00000034762
AA Change: N720Y

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
low complexity region 118 129 N/A INTRINSIC
low complexity region 242 255 N/A INTRINSIC
low complexity region 274 288 N/A INTRINSIC
low complexity region 334 357 N/A INTRINSIC
ZnF_C2H2 366 391 3.99e0 SMART
ZnF_C2H2 400 427 4.12e0 SMART
ZnF_C2H2 433 457 7.78e-3 SMART
ZnF_C2H2 463 487 1.45e-2 SMART
ZnF_C2H2 493 517 5.59e-4 SMART
low complexity region 543 557 N/A INTRINSIC
low complexity region 635 658 N/A INTRINSIC
low complexity region 666 686 N/A INTRINSIC
low complexity region 721 735 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106738
AA Change: N532Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102349
Gene: ENSMUSG00000034762
AA Change: N532Y

DomainStartEndE-ValueType
low complexity region 54 67 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 146 169 N/A INTRINSIC
ZnF_C2H2 178 203 3.99e0 SMART
ZnF_C2H2 212 239 4.12e0 SMART
ZnF_C2H2 245 269 7.78e-3 SMART
ZnF_C2H2 275 299 1.45e-2 SMART
ZnF_C2H2 305 329 5.59e-4 SMART
low complexity region 355 369 N/A INTRINSIC
low complexity region 447 470 N/A INTRINSIC
low complexity region 478 498 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GLIS1 is a GLI (MIM 165220)-related Kruppel-like zinc finger protein that functions as an activator and repressor of transcription (Kim et al., 2002 [PubMed 12042312]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mice do not exhibit any overt abnormalities, including behavior, kidney or tooth morphology, up to 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 130,952,767 (GRCm39) M238T probably benign Het
Acacb C T 5: 114,304,108 (GRCm39) S177F possibly damaging Het
Afap1l2 A G 19: 56,902,597 (GRCm39) V822A probably damaging Het
Alpk3 C T 7: 80,743,693 (GRCm39) P1170L probably damaging Het
Aox3 A G 1: 58,227,596 (GRCm39) I1234V probably damaging Het
Ascc1 G A 10: 59,848,381 (GRCm39) V103M probably null Het
Brca2 C G 5: 150,462,198 (GRCm39) T654S probably benign Het
Cblb T C 16: 51,972,899 (GRCm39) F410S probably damaging Het
Cep95 T A 11: 106,686,974 (GRCm39) N94K probably benign Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cpe T A 8: 65,047,945 (GRCm39) S440C probably damaging Het
Cspg4 C T 9: 56,795,381 (GRCm39) Q1039* probably null Het
Cul5 A T 9: 53,535,069 (GRCm39) S612T probably benign Het
Dapl1 T C 2: 59,315,112 (GRCm39) probably null Het
Deptor C T 15: 55,072,244 (GRCm39) T241M probably benign Het
Dnaaf1 A G 8: 120,309,454 (GRCm39) T181A possibly damaging Het
Dnajc11 G T 4: 152,053,045 (GRCm39) Q156H probably benign Het
Dst T C 1: 34,206,757 (GRCm39) V975A possibly damaging Het
Elf3 T A 1: 135,184,866 (GRCm39) S107C probably damaging Het
Enpp2 T A 15: 54,770,324 (GRCm39) D105V probably damaging Het
Fgd6 G A 10: 93,956,344 (GRCm39) V1008I probably benign Het
Frmpd2 C T 14: 33,276,850 (GRCm39) R1157* probably null Het
Gabrg2 A C 11: 41,858,474 (GRCm39) V218G probably benign Het
Gdpgp1 C T 7: 79,888,953 (GRCm39) A328V probably damaging Het
Grin2c G T 11: 115,146,107 (GRCm39) A546D probably damaging Het
Gtf3c5 G A 2: 28,458,592 (GRCm39) T433I possibly damaging Het
Jmjd6 C A 11: 116,734,055 (GRCm39) probably benign Het
Kctd14 T C 7: 97,106,891 (GRCm39) S49P probably damaging Het
Lamc2 T A 1: 153,006,521 (GRCm39) K877* probably null Het
Lgr4 T A 2: 109,836,858 (GRCm39) S397R probably damaging Het
Lrp2 A T 2: 69,262,541 (GRCm39) I4420N possibly damaging Het
Lyn A G 4: 3,783,089 (GRCm39) K441E possibly damaging Het
Minpp1 A T 19: 32,463,359 (GRCm39) S7C possibly damaging Het
Mrps9 T A 1: 42,901,808 (GRCm39) D105E probably damaging Het
Ncoa1 C A 12: 4,363,095 (GRCm39) A247S possibly damaging Het
Or52b4i G A 7: 102,191,515 (GRCm39) R124H possibly damaging Het
Or8c15 T C 9: 38,120,496 (GRCm39) V47A probably benign Het
Pabir1 G A 19: 24,454,552 (GRCm39) R57W probably benign Het
Pakap A G 4: 57,883,026 (GRCm39) K790E probably damaging Het
Pcdh15 G A 10: 74,430,022 (GRCm39) V1250I probably damaging Het
Pcdha12 A T 18: 37,153,409 (GRCm39) T43S probably damaging Het
Pkn2 G A 3: 142,516,480 (GRCm39) R549C probably benign Het
Plscr4 C T 9: 92,372,843 (GRCm39) R322* probably null Het
Polq T A 16: 36,881,004 (GRCm39) M1056K probably benign Het
Ppp1r12b A T 1: 134,803,793 (GRCm39) N455K probably benign Het
Rhbdf1 T A 11: 32,166,258 (GRCm39) M1L possibly damaging Het
Rspry1 G T 8: 95,349,635 (GRCm39) V8L probably benign Het
Slc6a20b A G 9: 123,436,666 (GRCm39) V249A probably damaging Het
Smok2b A T 17: 13,455,046 (GRCm39) H402L possibly damaging Het
Supt20 A T 3: 54,620,620 (GRCm39) N393I probably benign Het
Tcp11l1 T C 2: 104,528,993 (GRCm39) K102E probably damaging Het
Tpbgl T C 7: 99,274,798 (GRCm39) Y353C probably damaging Het
Usp24 A T 4: 106,287,741 (GRCm39) Q2465L probably damaging Het
Vmn2r116 T A 17: 23,605,946 (GRCm39) M286K probably damaging Het
Wnt16 C A 6: 22,291,188 (GRCm39) N205K possibly damaging Het
Xkr7 C A 2: 152,874,135 (GRCm39) F67L probably damaging Het
Zfp473 T G 7: 44,384,000 (GRCm39) E111A probably damaging Het
Zfp74 T C 7: 29,631,867 (GRCm39) K126E probably benign Het
Other mutations in Glis1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Glis1 APN 4 107,484,758 (GRCm39) missense probably benign 0.01
IGL02450:Glis1 APN 4 107,484,726 (GRCm39) missense probably benign 0.25
IGL03167:Glis1 APN 4 107,293,102 (GRCm39) missense possibly damaging 0.90
IGL03189:Glis1 APN 4 107,472,248 (GRCm39) missense probably damaging 1.00
IGL03377:Glis1 APN 4 107,489,478 (GRCm39) missense probably damaging 0.98
glenys UTSW 4 107,484,740 (GRCm39) missense possibly damaging 0.91
R0551:Glis1 UTSW 4 107,425,316 (GRCm39) splice site probably null
R0981:Glis1 UTSW 4 107,472,239 (GRCm39) missense probably damaging 1.00
R1036:Glis1 UTSW 4 107,489,461 (GRCm39) missense probably benign 0.05
R1527:Glis1 UTSW 4 107,425,123 (GRCm39) missense probably damaging 0.96
R1741:Glis1 UTSW 4 107,425,544 (GRCm39) missense probably damaging 1.00
R2937:Glis1 UTSW 4 107,489,488 (GRCm39) missense possibly damaging 0.89
R2938:Glis1 UTSW 4 107,489,488 (GRCm39) missense possibly damaging 0.89
R4223:Glis1 UTSW 4 107,425,042 (GRCm39) missense probably benign 0.01
R4412:Glis1 UTSW 4 107,491,915 (GRCm39) missense probably damaging 0.99
R4587:Glis1 UTSW 4 107,484,740 (GRCm39) missense possibly damaging 0.91
R4685:Glis1 UTSW 4 107,424,842 (GRCm39) missense probably benign 0.00
R4900:Glis1 UTSW 4 107,476,761 (GRCm39) missense probably damaging 1.00
R5138:Glis1 UTSW 4 107,480,302 (GRCm39) frame shift probably null
R5167:Glis1 UTSW 4 107,491,891 (GRCm39) missense probably damaging 1.00
R5511:Glis1 UTSW 4 107,293,074 (GRCm39) missense probably damaging 0.99
R5568:Glis1 UTSW 4 107,476,832 (GRCm39) missense probably damaging 0.99
R5807:Glis1 UTSW 4 107,425,279 (GRCm39) missense probably benign 0.00
R6006:Glis1 UTSW 4 107,425,103 (GRCm39) missense probably damaging 1.00
R6180:Glis1 UTSW 4 107,484,710 (GRCm39) missense probably benign 0.06
R6219:Glis1 UTSW 4 107,489,102 (GRCm39) missense probably benign 0.27
R6856:Glis1 UTSW 4 107,293,076 (GRCm39) missense probably damaging 0.96
R7278:Glis1 UTSW 4 107,292,880 (GRCm39) start codon destroyed probably null 0.53
R7877:Glis1 UTSW 4 107,491,900 (GRCm39) missense probably damaging 1.00
R7937:Glis1 UTSW 4 107,484,723 (GRCm39) missense possibly damaging 0.68
R7940:Glis1 UTSW 4 107,489,571 (GRCm39) missense probably damaging 1.00
R7954:Glis1 UTSW 4 107,476,854 (GRCm39) missense possibly damaging 0.82
R8078:Glis1 UTSW 4 107,425,099 (GRCm39) missense probably damaging 1.00
R8931:Glis1 UTSW 4 107,421,060 (GRCm39) missense probably benign 0.35
R9227:Glis1 UTSW 4 107,425,327 (GRCm39) missense probably benign 0.45
R9230:Glis1 UTSW 4 107,425,327 (GRCm39) missense probably benign 0.45
R9767:Glis1 UTSW 4 107,491,794 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCACACCCTCAATGCCTGG -3'
(R):5'- AGTCATTCTAGCAAGGGTGTAC -3'

Sequencing Primer
(F):5'- TGCCTGGACCGGACAACAAG -3'
(R):5'- TGTACCCTAGCTCAGGTAGAC -3'
Posted On 2020-09-15