Incidental Mutation 'R7940:Dnajc11'
ID 648994
Institutional Source Beutler Lab
Gene Symbol Dnajc11
Ensembl Gene ENSMUSG00000039768
Gene Name DnaJ heat shock protein family (Hsp40) member C11
Synonyms E030019A03Rik
MMRRC Submission 045986-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R7940 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 152018177-152066416 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 152053045 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 156 (Q156H)
Ref Sequence ENSEMBL: ENSMUSP00000051643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062904] [ENSMUST00000139069] [ENSMUST00000147625]
AlphaFold Q5U458
Predicted Effect probably benign
Transcript: ENSMUST00000062904
AA Change: Q156H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051643
Gene: ENSMUSG00000039768
AA Change: Q156H

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
Pfam:DUF3395 410 549 2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139069
AA Change: Q156H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000119604
Gene: ENSMUSG00000039768
AA Change: Q156H

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
coiled coil region 318 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147625
AA Change: Q118H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122140
Gene: ENSMUSG00000039768
AA Change: Q118H

DomainStartEndE-ValueType
DnaJ 1 36 2.51e-1 SMART
low complexity region 64 84 N/A INTRINSIC
Meta Mutation Damage Score 0.0788 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (56/57)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit motor neuron pathology, disorganized cristae and lymphoid abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 130,952,767 (GRCm39) M238T probably benign Het
Acacb C T 5: 114,304,108 (GRCm39) S177F possibly damaging Het
Afap1l2 A G 19: 56,902,597 (GRCm39) V822A probably damaging Het
Alpk3 C T 7: 80,743,693 (GRCm39) P1170L probably damaging Het
Aox3 A G 1: 58,227,596 (GRCm39) I1234V probably damaging Het
Ascc1 G A 10: 59,848,381 (GRCm39) V103M probably null Het
Brca2 C G 5: 150,462,198 (GRCm39) T654S probably benign Het
Cblb T C 16: 51,972,899 (GRCm39) F410S probably damaging Het
Cep95 T A 11: 106,686,974 (GRCm39) N94K probably benign Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cpe T A 8: 65,047,945 (GRCm39) S440C probably damaging Het
Cspg4 C T 9: 56,795,381 (GRCm39) Q1039* probably null Het
Cul5 A T 9: 53,535,069 (GRCm39) S612T probably benign Het
Dapl1 T C 2: 59,315,112 (GRCm39) probably null Het
Deptor C T 15: 55,072,244 (GRCm39) T241M probably benign Het
Dnaaf1 A G 8: 120,309,454 (GRCm39) T181A possibly damaging Het
Dst T C 1: 34,206,757 (GRCm39) V975A possibly damaging Het
Elf3 T A 1: 135,184,866 (GRCm39) S107C probably damaging Het
Enpp2 T A 15: 54,770,324 (GRCm39) D105V probably damaging Het
Fgd6 G A 10: 93,956,344 (GRCm39) V1008I probably benign Het
Frmpd2 C T 14: 33,276,850 (GRCm39) R1157* probably null Het
Gabrg2 A C 11: 41,858,474 (GRCm39) V218G probably benign Het
Gdpgp1 C T 7: 79,888,953 (GRCm39) A328V probably damaging Het
Glis1 C G 4: 107,489,571 (GRCm39) F719L probably damaging Het
Glis1 A T 4: 107,489,572 (GRCm39) N720Y probably damaging Het
Grin2c G T 11: 115,146,107 (GRCm39) A546D probably damaging Het
Gtf3c5 G A 2: 28,458,592 (GRCm39) T433I possibly damaging Het
Jmjd6 C A 11: 116,734,055 (GRCm39) probably benign Het
Kctd14 T C 7: 97,106,891 (GRCm39) S49P probably damaging Het
Lamc2 T A 1: 153,006,521 (GRCm39) K877* probably null Het
Lgr4 T A 2: 109,836,858 (GRCm39) S397R probably damaging Het
Lrp2 A T 2: 69,262,541 (GRCm39) I4420N possibly damaging Het
Lyn A G 4: 3,783,089 (GRCm39) K441E possibly damaging Het
Minpp1 A T 19: 32,463,359 (GRCm39) S7C possibly damaging Het
Mrps9 T A 1: 42,901,808 (GRCm39) D105E probably damaging Het
Ncoa1 C A 12: 4,363,095 (GRCm39) A247S possibly damaging Het
Or52b4i G A 7: 102,191,515 (GRCm39) R124H possibly damaging Het
Or8c15 T C 9: 38,120,496 (GRCm39) V47A probably benign Het
Pabir1 G A 19: 24,454,552 (GRCm39) R57W probably benign Het
Pakap A G 4: 57,883,026 (GRCm39) K790E probably damaging Het
Pcdh15 G A 10: 74,430,022 (GRCm39) V1250I probably damaging Het
Pcdha12 A T 18: 37,153,409 (GRCm39) T43S probably damaging Het
Pkn2 G A 3: 142,516,480 (GRCm39) R549C probably benign Het
Plscr4 C T 9: 92,372,843 (GRCm39) R322* probably null Het
Polq T A 16: 36,881,004 (GRCm39) M1056K probably benign Het
Ppp1r12b A T 1: 134,803,793 (GRCm39) N455K probably benign Het
Rhbdf1 T A 11: 32,166,258 (GRCm39) M1L possibly damaging Het
Rspry1 G T 8: 95,349,635 (GRCm39) V8L probably benign Het
Slc6a20b A G 9: 123,436,666 (GRCm39) V249A probably damaging Het
Smok2b A T 17: 13,455,046 (GRCm39) H402L possibly damaging Het
Supt20 A T 3: 54,620,620 (GRCm39) N393I probably benign Het
Tcp11l1 T C 2: 104,528,993 (GRCm39) K102E probably damaging Het
Tpbgl T C 7: 99,274,798 (GRCm39) Y353C probably damaging Het
Usp24 A T 4: 106,287,741 (GRCm39) Q2465L probably damaging Het
Vmn2r116 T A 17: 23,605,946 (GRCm39) M286K probably damaging Het
Wnt16 C A 6: 22,291,188 (GRCm39) N205K possibly damaging Het
Xkr7 C A 2: 152,874,135 (GRCm39) F67L probably damaging Het
Zfp473 T G 7: 44,384,000 (GRCm39) E111A probably damaging Het
Zfp74 T C 7: 29,631,867 (GRCm39) K126E probably benign Het
Other mutations in Dnajc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Dnajc11 APN 4 152,063,759 (GRCm39) missense probably damaging 0.99
IGL02253:Dnajc11 APN 4 152,034,976 (GRCm39) nonsense probably null
IGL02606:Dnajc11 APN 4 152,063,941 (GRCm39) missense probably benign 0.18
IGL02969:Dnajc11 APN 4 152,062,503 (GRCm39) missense probably benign 0.33
IGL03062:Dnajc11 APN 4 152,055,318 (GRCm39) missense possibly damaging 0.92
PIT4812001:Dnajc11 UTSW 4 152,037,346 (GRCm39) missense probably benign 0.04
R0601:Dnajc11 UTSW 4 152,054,393 (GRCm39) missense probably damaging 1.00
R0620:Dnajc11 UTSW 4 152,058,085 (GRCm39) missense possibly damaging 0.54
R0639:Dnajc11 UTSW 4 152,054,393 (GRCm39) missense probably damaging 1.00
R1694:Dnajc11 UTSW 4 152,063,730 (GRCm39) missense probably damaging 1.00
R4091:Dnajc11 UTSW 4 152,062,550 (GRCm39) unclassified probably benign
R4545:Dnajc11 UTSW 4 152,064,398 (GRCm39) missense probably damaging 1.00
R4548:Dnajc11 UTSW 4 152,058,074 (GRCm39) missense possibly damaging 0.93
R4720:Dnajc11 UTSW 4 152,052,996 (GRCm39) missense probably damaging 1.00
R4732:Dnajc11 UTSW 4 152,055,424 (GRCm39) unclassified probably benign
R4751:Dnajc11 UTSW 4 152,052,999 (GRCm39) missense probably benign 0.01
R4895:Dnajc11 UTSW 4 152,064,390 (GRCm39) missense probably damaging 1.00
R5122:Dnajc11 UTSW 4 152,061,454 (GRCm39) missense possibly damaging 0.63
R5127:Dnajc11 UTSW 4 152,054,271 (GRCm39) unclassified probably benign
R5174:Dnajc11 UTSW 4 152,064,441 (GRCm39) missense probably damaging 1.00
R5180:Dnajc11 UTSW 4 152,054,396 (GRCm39) missense probably damaging 1.00
R5319:Dnajc11 UTSW 4 152,052,983 (GRCm39) missense probably damaging 1.00
R5624:Dnajc11 UTSW 4 152,063,967 (GRCm39) missense probably benign
R6056:Dnajc11 UTSW 4 152,062,583 (GRCm39) unclassified probably benign
R6434:Dnajc11 UTSW 4 152,063,751 (GRCm39) missense probably damaging 1.00
R7635:Dnajc11 UTSW 4 152,053,068 (GRCm39) missense probably damaging 1.00
R7652:Dnajc11 UTSW 4 152,058,682 (GRCm39) missense probably damaging 0.99
R7937:Dnajc11 UTSW 4 152,034,909 (GRCm39) missense probably damaging 1.00
R8093:Dnajc11 UTSW 4 152,054,357 (GRCm39) missense probably damaging 1.00
R8361:Dnajc11 UTSW 4 152,055,368 (GRCm39) missense probably damaging 0.99
R8684:Dnajc11 UTSW 4 152,065,183 (GRCm39) makesense probably null
R9608:Dnajc11 UTSW 4 152,034,978 (GRCm39) missense possibly damaging 0.94
Z1176:Dnajc11 UTSW 4 152,018,240 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTGTCCTTCCGTGAAGTC -3'
(R):5'- GGCCAAATGGACATGCTTGC -3'

Sequencing Primer
(F):5'- TTCCGTGAAGTCAGATGCC -3'
(R):5'- CCAAATGGACATGCTTGCATGTTC -3'
Posted On 2020-09-15