Mutagenetix > Incidental Mutation

Incidental Mutation 'R7940:Brca2'

648996

Institutional Source

Beutler Lab

Gene Symbol

Brca2

Ensembl Gene

ENSMUSG00000041147

Gene Name

breast cancer 2, early onset

Synonyms

Fancd1, RAB163

MMRRC Submission

045986-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7940 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

150522630-150570329 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 150538733 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 654 (T654S)

Ref Sequence

ENSEMBL: ENSMUSP00000144676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044620] [ENSMUST00000202003] [ENSMUST00000202313]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000044620
AA Change: T654S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000038576
Gene: ENSMUSG00000041147
AA Change: T654S

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC
Pfam:BRCA2	982	1014	2.6e-13	PFAM
Pfam:BRCA2	1193	1225	3.9e-16	PFAM
low complexity region	1239	1252	N/A	INTRINSIC
Pfam:BRCA2	1395	1425	1.4e-13	PFAM
Pfam:BRCA2	1492	1524	1.8e-13	PFAM
Pfam:BRCA2	1624	1655	8.4e-12	PFAM
Pfam:BRCA2	1925	1957	8e-15	PFAM
Pfam:BRCA2	2005	2037	1.7e-11	PFAM
Pfam:BRCA-2_helical	2402	2588	1.3e-94	PFAM
Pfam:BRCA-2_OB1	2591	2717	5.3e-44	PFAM
Tower	2752	2793	2.37e-18	SMART
Pfam:BRCA-2_OB3	2971	3104	1.5e-49	PFAM
low complexity region	3197	3208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202003
AA Change: T654S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000144676
Gene: ENSMUSG00000041147
AA Change: T654S

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202313
AA Change: T654S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000144150
Gene: ENSMUSG00000041147
AA Change: T654S

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC
Pfam:BRCA2	982	1014	2.6e-13	PFAM
Pfam:BRCA2	1193	1225	3.9e-16	PFAM
low complexity region	1239	1252	N/A	INTRINSIC
Pfam:BRCA2	1395	1425	1.4e-13	PFAM
Pfam:BRCA2	1492	1524	1.8e-13	PFAM
Pfam:BRCA2	1624	1655	8.4e-12	PFAM
Pfam:BRCA2	1925	1957	8e-15	PFAM
Pfam:BRCA2	2005	2037	1.7e-11	PFAM
Pfam:BRCA-2_helical	2402	2588	1.3e-94	PFAM
Pfam:BRCA-2_OB1	2591	2717	5.3e-44	PFAM
Tower	2752	2793	2.37e-18	SMART
Pfam:BRCA-2_OB3	2971	3104	1.5e-49	PFAM
low complexity region	3197	3208	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA2 protein survive, are small, infertile, show improper tissue differentiation and develop lymphomas and carcinomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	A	G	7: 131,351,038	M238T	probably benign	Het
Acacb	C	T	5: 114,166,047	S177F	possibly damaging	Het
Afap1l2	A	G	19: 56,914,165	V822A	probably damaging	Het
Akap2	A	G	4: 57,883,026	K790E	probably damaging	Het
Alpk3	C	T	7: 81,093,945	P1170L	probably damaging	Het
Aox3	A	G	1: 58,188,437	I1234V	probably damaging	Het
Ascc1	G	A	10: 60,012,559	V103M	probably null	Het
Cblb	T	C	16: 52,152,536	F410S	probably damaging	Het
Cep95	T	A	11: 106,796,148	N94K	probably benign	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cpe	T	A	8: 64,594,911	S440C	probably damaging	Het
Cspg4	C	T	9: 56,888,097	Q1039*	probably null	Het
Cul5	A	T	9: 53,623,769	S612T	probably benign	Het
Dapl1	T	C	2: 59,484,768		probably null	Het
Deptor	C	T	15: 55,208,848	T241M	probably benign	Het
Dnaaf1	A	G	8: 119,582,715	T181A	possibly damaging	Het
Dnajc11	G	T	4: 151,968,588	Q156H	probably benign	Het
Dst	T	C	1: 34,167,676	V975A	possibly damaging	Het
Elf3	T	A	1: 135,257,128	S107C	probably damaging	Het
Enpp2	T	A	15: 54,906,928	D105V	probably damaging	Het
Fam122a	G	A	19: 24,477,188	R57W	probably benign	Het
Fgd6	G	A	10: 94,120,482	V1008I	probably benign	Het
Frmpd2	C	T	14: 33,554,893	R1157*	probably null	Het
Gabrg2	A	C	11: 41,967,647	V218G	probably benign	Het
Gdpgp1	C	T	7: 80,239,205	A328V	probably damaging	Het
Glis1	C	G	4: 107,632,374	F719L	probably damaging	Het
Glis1	A	T	4: 107,632,375	N720Y	probably damaging	Het
Grin2c	G	T	11: 115,255,281	A546D	probably damaging	Het
Gtf3c5	G	A	2: 28,568,580	T433I	possibly damaging	Het
Jmjd6	C	A	11: 116,843,229		probably benign	Het
Kctd14	T	C	7: 97,457,684	S49P	probably damaging	Het
Lamc2	T	A	1: 153,130,775	K877*	probably null	Het
Lgr4	T	A	2: 110,006,513	S397R	probably damaging	Het
Lrp2	A	T	2: 69,432,197	I4420N	possibly damaging	Het
Lyn	A	G	4: 3,783,089	K441E	possibly damaging	Het
Minpp1	A	T	19: 32,485,959	S7C	possibly damaging	Het
Mrps9	T	A	1: 42,862,648	D105E	probably damaging	Het
Ncoa1	C	A	12: 4,313,095	A247S	possibly damaging	Het
Olfr548-ps1	G	A	7: 102,542,308	R124H	possibly damaging	Het
Olfr893	T	C	9: 38,209,200	V47A	probably benign	Het
Pcdh15	G	A	10: 74,594,190	V1250I	probably damaging	Het
Pcdha12	A	T	18: 37,020,356	T43S	probably damaging	Het
Pkn2	G	A	3: 142,810,719	R549C	probably benign	Het
Plscr4	C	T	9: 92,490,790	R322*	probably null	Het
Polq	T	A	16: 37,060,642	M1056K	probably benign	Het
Ppp1r12b	A	T	1: 134,876,055	N455K	probably benign	Het
Rhbdf1	T	A	11: 32,216,258	M1L	possibly damaging	Het
Rspry1	G	T	8: 94,623,007	V8L	probably benign	Het
Slc6a20b	A	G	9: 123,607,601	V249A	probably damaging	Het
Smok2b	A	T	17: 13,236,159	H402L	possibly damaging	Het
Supt20	A	T	3: 54,713,199	N393I	probably benign	Het
Tcp11l1	T	C	2: 104,698,648	K102E	probably damaging	Het
Tpbgl	T	C	7: 99,625,591	Y353C	probably damaging	Het
Usp24	A	T	4: 106,430,544	Q2465L	probably damaging	Het
Vmn2r116	T	A	17: 23,386,972	M286K	probably damaging	Het
Wnt16	C	A	6: 22,291,189	N205K	possibly damaging	Het
Xkr7	C	A	2: 153,032,215	F67L	probably damaging	Het
Zfp473	T	G	7: 44,734,576	E111A	probably damaging	Het
Zfp74	T	C	7: 29,932,442	K126E	probably benign	Het

Other mutations in Brca2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Brca2	APN	5	150539898	missense	probably benign	0.18
IGL00392:Brca2	APN	5	150541240	missense	probably benign	0.02
IGL00557:Brca2	APN	5	150560538	missense	probably benign
IGL00798:Brca2	APN	5	150539463	missense	probably benign	0.30
IGL00933:Brca2	APN	5	150542404	missense	probably benign	0.04
IGL00964:Brca2	APN	5	150532310	missense	probably damaging	1.00
IGL01152:Brca2	APN	5	150542390	missense	probably damaging	0.99
IGL01577:Brca2	APN	5	150541620	nonsense	probably null
IGL01585:Brca2	APN	5	150539516	missense	possibly damaging	0.76
IGL01732:Brca2	APN	5	150542387	missense	probably benign	0.13
IGL01809:Brca2	APN	5	150531061	splice site	probably null
IGL01911:Brca2	APN	5	150567613	missense	probably damaging	0.96
IGL02113:Brca2	APN	5	150540979	missense	possibly damaging	0.95
IGL02313:Brca2	APN	5	150538661	missense	probably damaging	1.00
IGL02342:Brca2	APN	5	150542824	missense	possibly damaging	0.94
IGL02508:Brca2	APN	5	150543308	missense	possibly damaging	0.85
IGL02532:Brca2	APN	5	150550862	missense	probably damaging	1.00
IGL02646:Brca2	APN	5	150560790	missense	possibly damaging	0.89
IGL02738:Brca2	APN	5	150567035	missense	probably damaging	1.00
IGL02833:Brca2	APN	5	150541790	missense	possibly damaging	0.83
IGL02871:Brca2	APN	5	150542552	missense	probably benign	0.13
IGL02995:Brca2	APN	5	150529488	missense	probably damaging	1.00
IGL03105:Brca2	APN	5	150560485	missense	probably benign	0.02
BB007:Brca2	UTSW	5	150558510	missense	probably damaging	0.96
BB017:Brca2	UTSW	5	150558510	missense	probably damaging	0.96
R0219:Brca2	UTSW	5	150523175	splice site	probably benign
R0416:Brca2	UTSW	5	150569392	missense	possibly damaging	0.93
R0441:Brca2	UTSW	5	150541857	missense	probably damaging	0.96
R0548:Brca2	UTSW	5	150544935	missense	probably damaging	0.96
R0745:Brca2	UTSW	5	150544882	splice site	probably benign
R0799:Brca2	UTSW	5	150560193	missense	probably damaging	0.99
R1165:Brca2	UTSW	5	150542747	missense	probably damaging	0.98
R1247:Brca2	UTSW	5	150541274	missense	probably damaging	1.00
R1403:Brca2	UTSW	5	150542649	missense	probably benign	0.22
R1403:Brca2	UTSW	5	150542649	missense	probably benign	0.22
R1444:Brca2	UTSW	5	150542450	missense	probably benign
R1466:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1466:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1584:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1599:Brca2	UTSW	5	150548713	nonsense	probably null
R1600:Brca2	UTSW	5	150560830	splice site	probably benign
R1822:Brca2	UTSW	5	150540198	missense	probably benign	0.06
R1824:Brca2	UTSW	5	150536922	missense	possibly damaging	0.94
R2037:Brca2	UTSW	5	150540669	missense	probably benign
R2131:Brca2	UTSW	5	150557129	missense	probably damaging	1.00
R2203:Brca2	UTSW	5	150539502	missense	possibly damaging	0.58
R2208:Brca2	UTSW	5	150532344	missense	probably damaging	0.96
R2293:Brca2	UTSW	5	150560534	missense	possibly damaging	0.86
R2517:Brca2	UTSW	5	150539672	missense	probably benign	0.04
R2566:Brca2	UTSW	5	150541762	missense	probably benign	0.03
R3422:Brca2	UTSW	5	150543121	missense	possibly damaging	0.91
R3917:Brca2	UTSW	5	150540827	missense	probably damaging	0.96
R3946:Brca2	UTSW	5	150536704	missense	probably damaging	0.96
R4176:Brca2	UTSW	5	150539633	nonsense	probably null
R4255:Brca2	UTSW	5	150541169	missense	possibly damaging	0.92
R4450:Brca2	UTSW	5	150536053	missense	probably damaging	0.96
R4603:Brca2	UTSW	5	150536165	missense	possibly damaging	0.86
R4681:Brca2	UTSW	5	150552398	splice site	probably null
R4755:Brca2	UTSW	5	150559987	splice site	probably null
R4762:Brca2	UTSW	5	150531116	missense	probably benign	0.00
R4824:Brca2	UTSW	5	150539735	missense	probably damaging	1.00
R4887:Brca2	UTSW	5	150556937	missense	probably damaging	1.00
R5020:Brca2	UTSW	5	150560436	missense	probably damaging	1.00
R5159:Brca2	UTSW	5	150542108	missense	possibly damaging	0.93
R5216:Brca2	UTSW	5	150542980	missense	probably damaging	0.99
R5269:Brca2	UTSW	5	150539223	missense	possibly damaging	0.75
R5274:Brca2	UTSW	5	150539689	missense	probably benign	0.00
R5589:Brca2	UTSW	5	150557132	missense	possibly damaging	0.67
R5619:Brca2	UTSW	5	150557114	missense	probably damaging	0.96
R5641:Brca2	UTSW	5	150556899	missense	probably damaging	1.00
R5686:Brca2	UTSW	5	150540904	missense	probably benign	0.00
R5730:Brca2	UTSW	5	150569005	missense	possibly damaging	0.85
R5763:Brca2	UTSW	5	150548006	missense	possibly damaging	0.85
R5877:Brca2	UTSW	5	150543221	missense	possibly damaging	0.53
R5893:Brca2	UTSW	5	150569138	missense	probably benign	0.02
R5900:Brca2	UTSW	5	150541132	missense	probably benign	0.01
R5926:Brca2	UTSW	5	150534622	missense	probably benign	0.07
R5966:Brca2	UTSW	5	150543251	missense	probably damaging	0.99
R6025:Brca2	UTSW	5	150541575	frame shift	probably null
R6062:Brca2	UTSW	5	150556889	missense	probably damaging	0.96
R6141:Brca2	UTSW	5	150540637	missense	possibly damaging	0.91
R6244:Brca2	UTSW	5	150566978	missense	probably benign	0.08
R6508:Brca2	UTSW	5	150536593	missense	possibly damaging	0.91
R6519:Brca2	UTSW	5	150540979	missense	probably damaging	0.99
R6611:Brca2	UTSW	5	150536193	missense	probably damaging	0.99
R6698:Brca2	UTSW	5	150532394	missense	probably damaging	1.00
R6856:Brca2	UTSW	5	150540208	missense	possibly damaging	0.68
R6912:Brca2	UTSW	5	150541742	missense	probably damaging	0.99
R7002:Brca2	UTSW	5	150539918	missense	probably benign
R7025:Brca2	UTSW	5	150540478	missense	probably benign	0.39
R7151:Brca2	UTSW	5	150541436	missense	probably benign	0.12
R7202:Brca2	UTSW	5	150532354	missense	probably benign	0.03
R7365:Brca2	UTSW	5	150532337	missense	probably damaging	0.99
R7510:Brca2	UTSW	5	150536691	missense	possibly damaging	0.85
R7612:Brca2	UTSW	5	150540611	missense	probably benign	0.03
R7682:Brca2	UTSW	5	150543153	missense	probably benign
R7890:Brca2	UTSW	5	150539381	missense	possibly damaging	0.83
R7930:Brca2	UTSW	5	150558510	missense	probably damaging	0.96
R8054:Brca2	UTSW	5	150536504	missense	probably benign	0.02
R8056:Brca2	UTSW	5	150569306	missense	possibly damaging	0.85
R8080:Brca2	UTSW	5	150539892	missense	probably benign	0.11
R8094:Brca2	UTSW	5	150536169	missense	possibly damaging	0.85
R8306:Brca2	UTSW	5	150536663	missense	possibly damaging	0.91
R8401:Brca2	UTSW	5	150552352	missense	probably damaging	1.00
R8523:Brca2	UTSW	5	150560148	missense	possibly damaging	0.75
R8784:Brca2	UTSW	5	150548661	nonsense	probably null
R8791:Brca2	UTSW	5	150542596	missense	possibly damaging	0.92
R8832:Brca2	UTSW	5	150542146	missense	possibly damaging	0.91
R8838:Brca2	UTSW	5	150541540	missense	possibly damaging	0.91
R8845:Brca2	UTSW	5	150543382	missense	possibly damaging	0.85
R8898:Brca2	UTSW	5	150569033	missense	possibly damaging	0.53
R8914:Brca2	UTSW	5	150541743	missense	probably damaging	0.96
R8935:Brca2	UTSW	5	150568981	missense	possibly damaging	0.70
R9014:Brca2	UTSW	5	150541754	missense	probably benign
R9023:Brca2	UTSW	5	150541895	missense	probably benign	0.07
R9094:Brca2	UTSW	5	150552305	missense	probably benign	0.08
R9195:Brca2	UTSW	5	150539953	missense	possibly damaging	0.83
R9198:Brca2	UTSW	5	150536512	missense	possibly damaging	0.91
R9314:Brca2	UTSW	5	150550894	missense	probably damaging	0.96
R9408:Brca2	UTSW	5	150541517	missense	probably damaging	1.00
R9459:Brca2	UTSW	5	150540629	missense	probably damaging	0.98
R9512:Brca2	UTSW	5	150531081	missense	probably benign	0.40
R9622:Brca2	UTSW	5	150556945	missense	probably damaging	0.96
R9777:Brca2	UTSW	5	150557114	missense	probably damaging	0.99
Z1088:Brca2	UTSW	5	150542763	missense	probably damaging	0.96
Z1186:Brca2	UTSW	5	150536583	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CAGGCACTTCACTGACTAAGC -3'
(R):5'- CTGAGTTGCACTGCTGAAGG -3'

Sequencing Primer
(F):5'- GAACTCACTCTGTAGATCAGACTGG -3'
(R):5'- TTGCACTGCTGAAGGAAGAC -3'

Posted On

2020-09-15