Incidental Mutation 'R7940:Brca2'
ID 648996
Institutional Source Beutler Lab
Gene Symbol Brca2
Ensembl Gene ENSMUSG00000041147
Gene Name breast cancer 2, early onset
Synonyms Fancd1, RAB163
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7940 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 150522630-150570329 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 150538733 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 654 (T654S)
Ref Sequence ENSEMBL: ENSMUSP00000144676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044620] [ENSMUST00000202003] [ENSMUST00000202313]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000044620
AA Change: T654S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038576
Gene: ENSMUSG00000041147
AA Change: T654S

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202003
AA Change: T654S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144676
Gene: ENSMUSG00000041147
AA Change: T654S

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202313
AA Change: T654S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144150
Gene: ENSMUSG00000041147
AA Change: T654S

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
low complexity region 100 123 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 746 761 N/A INTRINSIC
low complexity region 904 917 N/A INTRINSIC
Pfam:BRCA2 982 1014 2.6e-13 PFAM
Pfam:BRCA2 1193 1225 3.9e-16 PFAM
low complexity region 1239 1252 N/A INTRINSIC
Pfam:BRCA2 1395 1425 1.4e-13 PFAM
Pfam:BRCA2 1492 1524 1.8e-13 PFAM
Pfam:BRCA2 1624 1655 8.4e-12 PFAM
Pfam:BRCA2 1925 1957 8e-15 PFAM
Pfam:BRCA2 2005 2037 1.7e-11 PFAM
Pfam:BRCA-2_helical 2402 2588 1.3e-94 PFAM
Pfam:BRCA-2_OB1 2591 2717 5.3e-44 PFAM
Tower 2752 2793 2.37e-18 SMART
Pfam:BRCA-2_OB3 2971 3104 1.5e-49 PFAM
low complexity region 3197 3208 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA2 protein survive, are small, infertile, show improper tissue differentiation and develop lymphomas and carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 131,351,038 M238T probably benign Het
Acacb C T 5: 114,166,047 S177F possibly damaging Het
Afap1l2 A G 19: 56,914,165 V822A probably damaging Het
Akap2 A G 4: 57,883,026 K790E probably damaging Het
Alpk3 C T 7: 81,093,945 P1170L probably damaging Het
Aox3 A G 1: 58,188,437 I1234V probably damaging Het
Ascc1 G A 10: 60,012,559 V103M probably null Het
Cblb T C 16: 52,152,536 F410S probably damaging Het
Cep95 T A 11: 106,796,148 N94K probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cpe T A 8: 64,594,911 S440C probably damaging Het
Cspg4 C T 9: 56,888,097 Q1039* probably null Het
Cul5 A T 9: 53,623,769 S612T probably benign Het
Dapl1 T C 2: 59,484,768 probably null Het
Deptor C T 15: 55,208,848 T241M probably benign Het
Dnaaf1 A G 8: 119,582,715 T181A possibly damaging Het
Dnajc11 G T 4: 151,968,588 Q156H probably benign Het
Dst T C 1: 34,167,676 V975A possibly damaging Het
Elf3 T A 1: 135,257,128 S107C probably damaging Het
Enpp2 T A 15: 54,906,928 D105V probably damaging Het
Fam122a G A 19: 24,477,188 R57W probably benign Het
Fgd6 G A 10: 94,120,482 V1008I probably benign Het
Frmpd2 C T 14: 33,554,893 R1157* probably null Het
Gabrg2 A C 11: 41,967,647 V218G probably benign Het
Gdpgp1 C T 7: 80,239,205 A328V probably damaging Het
Glis1 C G 4: 107,632,374 F719L probably damaging Het
Glis1 A T 4: 107,632,375 N720Y probably damaging Het
Grin2c G T 11: 115,255,281 A546D probably damaging Het
Gtf3c5 G A 2: 28,568,580 T433I possibly damaging Het
Jmjd6 C A 11: 116,843,229 probably benign Het
Kctd14 T C 7: 97,457,684 S49P probably damaging Het
Lamc2 T A 1: 153,130,775 K877* probably null Het
Lgr4 T A 2: 110,006,513 S397R probably damaging Het
Lrp2 A T 2: 69,432,197 I4420N possibly damaging Het
Lyn A G 4: 3,783,089 K441E possibly damaging Het
Minpp1 A T 19: 32,485,959 S7C possibly damaging Het
Mrps9 T A 1: 42,862,648 D105E probably damaging Het
Ncoa1 C A 12: 4,313,095 A247S possibly damaging Het
Olfr548-ps1 G A 7: 102,542,308 R124H possibly damaging Het
Olfr893 T C 9: 38,209,200 V47A probably benign Het
Pcdh15 G A 10: 74,594,190 V1250I probably damaging Het
Pcdha12 A T 18: 37,020,356 T43S probably damaging Het
Pkn2 G A 3: 142,810,719 R549C probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Polq T A 16: 37,060,642 M1056K probably benign Het
Ppp1r12b A T 1: 134,876,055 N455K probably benign Het
Rhbdf1 T A 11: 32,216,258 M1L possibly damaging Het
Rspry1 G T 8: 94,623,007 V8L probably benign Het
Slc6a20b A G 9: 123,607,601 V249A probably damaging Het
Smok2b A T 17: 13,236,159 H402L possibly damaging Het
Supt20 A T 3: 54,713,199 N393I probably benign Het
Tcp11l1 T C 2: 104,698,648 K102E probably damaging Het
Tpbgl T C 7: 99,625,591 Y353C probably damaging Het
Usp24 A T 4: 106,430,544 Q2465L probably damaging Het
Vmn2r116 T A 17: 23,386,972 M286K probably damaging Het
Wnt16 C A 6: 22,291,189 N205K possibly damaging Het
Xkr7 C A 2: 153,032,215 F67L probably damaging Het
Zfp473 T G 7: 44,734,576 E111A probably damaging Het
Zfp74 T C 7: 29,932,442 K126E probably benign Het
Other mutations in Brca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Brca2 APN 5 150539898 missense probably benign 0.18
IGL00392:Brca2 APN 5 150541240 missense probably benign 0.02
IGL00557:Brca2 APN 5 150560538 missense probably benign
IGL00798:Brca2 APN 5 150539463 missense probably benign 0.30
IGL00933:Brca2 APN 5 150542404 missense probably benign 0.04
IGL00964:Brca2 APN 5 150532310 missense probably damaging 1.00
IGL01152:Brca2 APN 5 150542390 missense probably damaging 0.99
IGL01577:Brca2 APN 5 150541620 nonsense probably null
IGL01585:Brca2 APN 5 150539516 missense possibly damaging 0.76
IGL01732:Brca2 APN 5 150542387 missense probably benign 0.13
IGL01809:Brca2 APN 5 150531061 splice site probably null
IGL01911:Brca2 APN 5 150567613 missense probably damaging 0.96
IGL02113:Brca2 APN 5 150540979 missense possibly damaging 0.95
IGL02313:Brca2 APN 5 150538661 missense probably damaging 1.00
IGL02342:Brca2 APN 5 150542824 missense possibly damaging 0.94
IGL02508:Brca2 APN 5 150543308 missense possibly damaging 0.85
IGL02532:Brca2 APN 5 150550862 missense probably damaging 1.00
IGL02646:Brca2 APN 5 150560790 missense possibly damaging 0.89
IGL02738:Brca2 APN 5 150567035 missense probably damaging 1.00
IGL02833:Brca2 APN 5 150541790 missense possibly damaging 0.83
IGL02871:Brca2 APN 5 150542552 missense probably benign 0.13
IGL02995:Brca2 APN 5 150529488 missense probably damaging 1.00
IGL03105:Brca2 APN 5 150560485 missense probably benign 0.02
BB007:Brca2 UTSW 5 150558510 missense probably damaging 0.96
BB017:Brca2 UTSW 5 150558510 missense probably damaging 0.96
R0219:Brca2 UTSW 5 150523175 splice site probably benign
R0416:Brca2 UTSW 5 150569392 missense possibly damaging 0.93
R0441:Brca2 UTSW 5 150541857 missense probably damaging 0.96
R0548:Brca2 UTSW 5 150544935 missense probably damaging 0.96
R0745:Brca2 UTSW 5 150544882 splice site probably benign
R0799:Brca2 UTSW 5 150560193 missense probably damaging 0.99
R1165:Brca2 UTSW 5 150542747 missense probably damaging 0.98
R1247:Brca2 UTSW 5 150541274 missense probably damaging 1.00
R1403:Brca2 UTSW 5 150542649 missense probably benign 0.22
R1403:Brca2 UTSW 5 150542649 missense probably benign 0.22
R1444:Brca2 UTSW 5 150542450 missense probably benign
R1466:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1466:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1584:Brca2 UTSW 5 150552258 missense probably damaging 0.99
R1599:Brca2 UTSW 5 150548713 nonsense probably null
R1600:Brca2 UTSW 5 150560830 splice site probably benign
R1822:Brca2 UTSW 5 150540198 missense probably benign 0.06
R1824:Brca2 UTSW 5 150536922 missense possibly damaging 0.94
R2037:Brca2 UTSW 5 150540669 missense probably benign
R2131:Brca2 UTSW 5 150557129 missense probably damaging 1.00
R2203:Brca2 UTSW 5 150539502 missense possibly damaging 0.58
R2208:Brca2 UTSW 5 150532344 missense probably damaging 0.96
R2293:Brca2 UTSW 5 150560534 missense possibly damaging 0.86
R2517:Brca2 UTSW 5 150539672 missense probably benign 0.04
R2566:Brca2 UTSW 5 150541762 missense probably benign 0.03
R3422:Brca2 UTSW 5 150543121 missense possibly damaging 0.91
R3917:Brca2 UTSW 5 150540827 missense probably damaging 0.96
R3946:Brca2 UTSW 5 150536704 missense probably damaging 0.96
R4176:Brca2 UTSW 5 150539633 nonsense probably null
R4255:Brca2 UTSW 5 150541169 missense possibly damaging 0.92
R4450:Brca2 UTSW 5 150536053 missense probably damaging 0.96
R4603:Brca2 UTSW 5 150536165 missense possibly damaging 0.86
R4681:Brca2 UTSW 5 150552398 splice site probably null
R4755:Brca2 UTSW 5 150559987 splice site probably null
R4762:Brca2 UTSW 5 150531116 missense probably benign 0.00
R4824:Brca2 UTSW 5 150539735 missense probably damaging 1.00
R4887:Brca2 UTSW 5 150556937 missense probably damaging 1.00
R5020:Brca2 UTSW 5 150560436 missense probably damaging 1.00
R5159:Brca2 UTSW 5 150542108 missense possibly damaging 0.93
R5216:Brca2 UTSW 5 150542980 missense probably damaging 0.99
R5269:Brca2 UTSW 5 150539223 missense possibly damaging 0.75
R5274:Brca2 UTSW 5 150539689 missense probably benign 0.00
R5589:Brca2 UTSW 5 150557132 missense possibly damaging 0.67
R5619:Brca2 UTSW 5 150557114 missense probably damaging 0.96
R5641:Brca2 UTSW 5 150556899 missense probably damaging 1.00
R5686:Brca2 UTSW 5 150540904 missense probably benign 0.00
R5730:Brca2 UTSW 5 150569005 missense possibly damaging 0.85
R5763:Brca2 UTSW 5 150548006 missense possibly damaging 0.85
R5877:Brca2 UTSW 5 150543221 missense possibly damaging 0.53
R5893:Brca2 UTSW 5 150569138 missense probably benign 0.02
R5900:Brca2 UTSW 5 150541132 missense probably benign 0.01
R5926:Brca2 UTSW 5 150534622 missense probably benign 0.07
R5966:Brca2 UTSW 5 150543251 missense probably damaging 0.99
R6025:Brca2 UTSW 5 150541575 frame shift probably null
R6062:Brca2 UTSW 5 150556889 missense probably damaging 0.96
R6141:Brca2 UTSW 5 150540637 missense possibly damaging 0.91
R6244:Brca2 UTSW 5 150566978 missense probably benign 0.08
R6508:Brca2 UTSW 5 150536593 missense possibly damaging 0.91
R6519:Brca2 UTSW 5 150540979 missense probably damaging 0.99
R6611:Brca2 UTSW 5 150536193 missense probably damaging 0.99
R6698:Brca2 UTSW 5 150532394 missense probably damaging 1.00
R6856:Brca2 UTSW 5 150540208 missense possibly damaging 0.68
R6912:Brca2 UTSW 5 150541742 missense probably damaging 0.99
R7002:Brca2 UTSW 5 150539918 missense probably benign
R7025:Brca2 UTSW 5 150540478 missense probably benign 0.39
R7151:Brca2 UTSW 5 150541436 missense probably benign 0.12
R7202:Brca2 UTSW 5 150532354 missense probably benign 0.03
R7365:Brca2 UTSW 5 150532337 missense probably damaging 0.99
R7510:Brca2 UTSW 5 150536691 missense possibly damaging 0.85
R7612:Brca2 UTSW 5 150540611 missense probably benign 0.03
R7682:Brca2 UTSW 5 150543153 missense probably benign
R7890:Brca2 UTSW 5 150539381 missense possibly damaging 0.83
R7930:Brca2 UTSW 5 150558510 missense probably damaging 0.96
R8054:Brca2 UTSW 5 150536504 missense probably benign 0.02
R8056:Brca2 UTSW 5 150569306 missense possibly damaging 0.85
R8080:Brca2 UTSW 5 150539892 missense probably benign 0.11
R8094:Brca2 UTSW 5 150536169 missense possibly damaging 0.85
R8306:Brca2 UTSW 5 150536663 missense possibly damaging 0.91
R8401:Brca2 UTSW 5 150552352 missense probably damaging 1.00
R8523:Brca2 UTSW 5 150560148 missense possibly damaging 0.75
R8784:Brca2 UTSW 5 150548661 nonsense probably null
R8791:Brca2 UTSW 5 150542596 missense possibly damaging 0.92
R8832:Brca2 UTSW 5 150542146 missense possibly damaging 0.91
R8838:Brca2 UTSW 5 150541540 missense possibly damaging 0.91
R8845:Brca2 UTSW 5 150543382 missense possibly damaging 0.85
R8898:Brca2 UTSW 5 150569033 missense possibly damaging 0.53
R8914:Brca2 UTSW 5 150541743 missense probably damaging 0.96
R8935:Brca2 UTSW 5 150568981 missense possibly damaging 0.70
R9014:Brca2 UTSW 5 150541754 missense probably benign
R9023:Brca2 UTSW 5 150541895 missense probably benign 0.07
R9094:Brca2 UTSW 5 150552305 missense probably benign 0.08
R9195:Brca2 UTSW 5 150539953 missense possibly damaging 0.83
R9198:Brca2 UTSW 5 150536512 missense possibly damaging 0.91
R9314:Brca2 UTSW 5 150550894 missense probably damaging 0.96
R9408:Brca2 UTSW 5 150541517 missense probably damaging 1.00
R9459:Brca2 UTSW 5 150540629 missense probably damaging 0.98
Z1088:Brca2 UTSW 5 150542763 missense probably damaging 0.96
Z1186:Brca2 UTSW 5 150536583 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGGCACTTCACTGACTAAGC -3'
(R):5'- CTGAGTTGCACTGCTGAAGG -3'

Sequencing Primer
(F):5'- GAACTCACTCTGTAGATCAGACTGG -3'
(R):5'- TTGCACTGCTGAAGGAAGAC -3'
Posted On 2020-09-15