Incidental Mutation 'R0015:Cdh5'
ID64900
Institutional Source Beutler Lab
Gene Symbol Cdh5
Ensembl Gene ENSMUSG00000031871
Gene Namecadherin 5
SynonymsVECD, VEcad, VE-cadherin, CD144, VE-Cad, 7B4/cadherin-5, VEC
MMRRC Submission 038310-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0015 (G1)
Quality Score136
Status Validated
Chromosome8
Chromosomal Location104101625-104144511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104140927 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 612 (T612I)
Ref Sequence ENSEMBL: ENSMUSP00000034339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034339]
PDB Structure
NMR structure of mouse Par3-PDZ3 in complex with VE-Cadherin C-terminus [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000034339
AA Change: T612I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034339
Gene: ENSMUSG00000031871
AA Change: T612I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 66 147 3.03e-10 SMART
CA 171 254 3.19e-18 SMART
CA 278 370 7.92e-14 SMART
CA 392 476 1.09e-16 SMART
CA 499 583 2.16e-6 SMART
transmembrane domain 598 620 N/A INTRINSIC
Pfam:Cadherin_C 625 776 1.1e-43 PFAM
Meta Mutation Damage Score 0.0672 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein die in utero due to vascular insufficiency, caused by increased endothelial apoptosis. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous inactivation or cytosolic truncation of this gene causes embryonic growth retardation, abnormal somite and heart development, impaired remodeling and maturation of endothelial cells, increased endothelial apoptosis and severe vascular defects leading to embryonic death at midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,186,184 R408H probably damaging Het
A130050O07Rik A G 1: 137,928,656 Y23C unknown Het
Adcy3 G A 12: 4,195,260 probably null Het
Aldh6a1 G A 12: 84,441,780 L86F probably damaging Het
Arl10 G T 13: 54,575,957 probably benign Het
Armc3 A G 2: 19,296,321 probably null Het
Astn2 T G 4: 66,266,382 probably null Het
Cacna1d G A 14: 30,114,971 T804I probably benign Het
Ccny A C 18: 9,316,682 probably benign Het
Cfap58 A G 19: 48,029,100 M800V probably benign Het
Clrn1 A T 3: 58,846,427 I171K probably damaging Het
Cnp T A 11: 100,578,908 probably null Het
Col12a1 T C 9: 79,651,385 T1933A probably damaging Het
Cwf19l2 A G 9: 3,454,666 S660G probably benign Het
Dync1i2 C A 2: 71,214,484 R13S probably damaging Het
Eps8l1 A T 7: 4,477,557 probably benign Het
Espn T C 4: 152,139,152 T188A possibly damaging Het
F2 T C 2: 91,630,607 E260G probably benign Het
Fat4 T A 3: 38,982,503 S3435T probably damaging Het
Fchsd1 A G 18: 37,962,959 C533R probably benign Het
Fstl5 G A 3: 76,322,191 V100M probably damaging Het
Gls2 T G 10: 128,209,350 L572R probably damaging Het
Gm20939 A T 17: 94,876,768 E281D probably benign Het
Gpr35 T G 1: 92,983,232 L222W probably damaging Het
Hsf5 C A 11: 87,657,335 H615N probably benign Het
Id2 C T 12: 25,095,803 D70N probably damaging Het
Ints2 T C 11: 86,249,287 T240A probably damaging Het
Kcnn3 A C 3: 89,662,773 D631A probably damaging Het
Klhdc8a A G 1: 132,303,005 T203A probably damaging Het
Lama4 C T 10: 39,075,436 T1059M possibly damaging Het
Lgals8 A G 13: 12,447,298 L226P probably damaging Het
Lifr T A 15: 7,188,186 probably null Het
Lonp1 T A 17: 56,618,406 Q462L probably benign Het
Lypd1 A G 1: 125,910,438 V48A possibly damaging Het
Mapkapk2 A G 1: 131,097,326 I67T possibly damaging Het
Mbd3l1 A T 9: 18,484,858 D93V probably benign Het
Mdh1b T C 1: 63,721,800 probably benign Het
Myh7b C T 2: 155,622,286 P569L probably damaging Het
Ncapd3 C A 9: 27,051,809 A470E probably damaging Het
Ndrg2 A G 14: 51,910,445 probably benign Het
Nprl2 A T 9: 107,544,419 I209F probably damaging Het
Ntrk1 A G 3: 87,791,750 probably benign Het
Olfm2 T C 9: 20,668,741 E268G probably damaging Het
Olfr884 T A 9: 38,047,667 Y148* probably null Het
Pcf11 T A 7: 92,658,317 H881L probably benign Het
Pde10a A G 17: 8,977,197 D640G probably damaging Het
Pde9a G A 17: 31,386,356 probably null Het
Pianp G T 6: 125,001,540 G236V probably damaging Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Ppp1r3a A G 6: 14,717,661 S1085P possibly damaging Het
Pter G A 2: 13,001,000 G328D probably damaging Het
Rad51 T A 2: 119,116,327 M5K probably benign Het
Rbm43 T A 2: 51,925,667 I181F probably benign Het
Rgs12 T C 5: 35,022,776 probably benign Het
Rnf213 A C 11: 119,441,606 D2547A possibly damaging Het
Slc20a2 C A 8: 22,535,345 A21E probably damaging Het
Stab2 A G 10: 86,843,617 S2503P probably benign Het
Sv2b A T 7: 75,125,641 F479L probably damaging Het
Sybu T C 15: 44,673,500 R349G probably damaging Het
Tead3 T C 17: 28,341,351 Y2C probably damaging Het
Tnrc6c T A 11: 117,721,458 N307K probably damaging Het
Ubxn11 C G 4: 134,116,025 probably null Het
Ust T C 10: 8,330,065 probably benign Het
Vmn2r116 T A 17: 23,401,849 N852K probably benign Het
Zgrf1 T C 3: 127,555,397 probably benign Het
Other mutations in Cdh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Cdh5 APN 8 104137817 missense probably damaging 1.00
IGL02506:Cdh5 APN 8 104137822 missense probably damaging 1.00
IGL02737:Cdh5 APN 8 104142928 missense probably damaging 1.00
IGL03287:Cdh5 APN 8 104128115 missense probably damaging 1.00
IGL03297:Cdh5 APN 8 104128199 missense probably damaging 1.00
R0015:Cdh5 UTSW 8 104140927 missense probably benign
R0126:Cdh5 UTSW 8 104140682 critical splice acceptor site probably null
R0167:Cdh5 UTSW 8 104136735 missense possibly damaging 0.51
R0592:Cdh5 UTSW 8 104130902 splice site probably null
R1760:Cdh5 UTSW 8 104128169 missense probably benign
R1826:Cdh5 UTSW 8 104131091 missense possibly damaging 0.93
R1827:Cdh5 UTSW 8 104112909 missense possibly damaging 0.96
R1840:Cdh5 UTSW 8 104126616 nonsense probably null
R1993:Cdh5 UTSW 8 104137815 missense probably damaging 0.97
R2219:Cdh5 UTSW 8 104142906 missense possibly damaging 0.94
R2239:Cdh5 UTSW 8 104125672 missense possibly damaging 0.54
R2281:Cdh5 UTSW 8 104125733 missense probably damaging 1.00
R2380:Cdh5 UTSW 8 104125672 missense possibly damaging 0.54
R3418:Cdh5 UTSW 8 104129370 missense probably damaging 0.98
R3419:Cdh5 UTSW 8 104129370 missense probably damaging 0.98
R3429:Cdh5 UTSW 8 104130968 missense possibly damaging 0.91
R4491:Cdh5 UTSW 8 104113040 missense probably damaging 1.00
R4823:Cdh5 UTSW 8 104142669 missense probably benign 0.00
R5071:Cdh5 UTSW 8 104140702 missense probably damaging 0.99
R5265:Cdh5 UTSW 8 104142739 missense probably benign 0.00
R5383:Cdh5 UTSW 8 104137847 missense probably benign 0.17
R5447:Cdh5 UTSW 8 104129362 missense probably damaging 0.99
R5580:Cdh5 UTSW 8 104125494 nonsense probably null
R5876:Cdh5 UTSW 8 104142577 missense probably damaging 1.00
R5934:Cdh5 UTSW 8 104138268 missense probably benign 0.00
R6378:Cdh5 UTSW 8 104126536 splice site probably null
R7110:Cdh5 UTSW 8 104140768 missense probably damaging 1.00
R7141:Cdh5 UTSW 8 104113001 missense probably benign 0.20
R7324:Cdh5 UTSW 8 104142793 missense probably damaging 1.00
R7658:Cdh5 UTSW 8 104129401 critical splice donor site probably null
X0067:Cdh5 UTSW 8 104142537 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCCAACATCACGGTCAAGTATGGG -3'
(R):5'- ACACATGCTAACGTGCTCTGCC -3'

Sequencing Primer
(F):5'- CGGTCAAGTATGGGCAGTTTAATC -3'
(R):5'- tgctctgcccctgagatac -3'
Posted On2013-08-06